Protein Synthesis Claymation

I know the animation and photo quality aren't all that great, but it took a while. I made it with JPEG video, a stop motion animation program and I edited it in Windows Movie Maker. It is 15 frames per second and 341 pictures.

This video shows transcription of DNA to RNA and translation of RNA to a polypeptide. Here is a slightly more detailed explanation of what is happening because a few things had to be cut:

The DNA polymerase (not shown in movie) unzips the DNA. Then the RNA forms, by matching each guanine (G) of the DNA to RNA's cytosine (C) and vice versa; and matching each thymine (T) to adenine (A); and each A to uracil (U). In the movie, T is red, C is brown, G is blue, A is yellow, and U is green. The movie doesn't show this, but the RNA is made by matching each nucleotide one at a time, instead of coming in fully formed as the movie depicts. The enzyme called RNA polymerase is what catalyzes this process, but that also isn't shown in the movie.

The DNA goes back together in helix form and the mRNA (messenger RNA, which was just made) moves to the ribosome, an organelle. The ribosome is made up of protein and RNA called rRNA (ribosomal RNA). This is where translation begins. Only two codons (a section of RNA with three nucleotides) can fit in the ribosome at a time. The tRNA (transfer RNA), which are the brown crosses with nucleotides, come into the ribosome. The nucleotides on the bottom of the tRNA, called anti-codons, match the codons of the mRNA. Each tRNA is attached to a specific amino acid, which are the colored balls in the video. The type of amino acid is based on the codon on the mRNA that the tRNA matches. The codons in this video code for Valine, Aspartate, Threonine, Histidine, Tyrosine, and Phenylalanine. The last codon doesn't have a matching tRNA because it is a stop codon which signals for the translation process to stop. These amino acids bond through dehydration synthesis as the process continues to form a polypeptide, thus making protein.

DNA code used in video that was transcribed: CAACTGTGTGTAATAAAGATC
RNA code that was transcribed from above DNA and then translated: GUUGACACACAUUAUUUCUAG

Category:

Education

Tags:

• biology
• protein
• synthesis
• claymation
• stop
• motion
• stopmotion
• dna
• rna
• polypeptide
• science

[DillonMintoff]

Short and sweet, explains the basic details. Great video!

Try making a video on Transcription :) !

[Chaud888Musiq]

Wow, i think watching this is better than reading textbook/notes. haha, thanks so much. [: !

[Skatedatbake101]

i looooooooooooove this video, for the past two years (mid terms, finals, mid terms, now finals) I've watched this video to remind myself of how protein synthesis works!

[CzarThePlezer]

@acadam1832 much like your comment, muahahahaha I WIN

[LONEstudios]

Veeeeeery superficial explanation

[ColourfulRaiin]

this fucking video helped me understand thiss

[acadam1832]

useless video

[FandSproduction]

Neat, I plan to make a movie of genetics in claymation for my Advanced Biology class.

[Piker44]

face

[kto0808]

thank you!

[skatedatbake202]

actually, this video helped me more than any of the other looong educational videos! xD that was like.. so simple! hahahahahaha thanks!