A genome is all of a living thing's genetic material. It is the entire set of hereditary instructions for building, running, and maintaining an organism, and passing life on to the next generation. The whole shebang.
AGTCCGCGAATACAGGCTCGGT
In most living things, the genome is made of a chemical called DNA. The genome contains genes, which are packaged in chromosomes and affect specific characteristics of the organism.
Imagine these relationships as a set of Chinese boxes nested one inside the other. The largest box represents the genome. Inside it, a smaller box represents the chromosomes. Inside that is a box representing genes, and inside that, finally, is the smallest box, the DNA.
In short, the genome is divided into chromosomes, chromosomes contain genes, and genes are made of DNA. 46 for Human Adults and 48 for Great Apes. However, Human chromosome#2 is our fused ape chromosome.
Each one of earth's species has its own distinctive genome: the dog genome, the wheat genome, the genomes of the cow, cold virus, bok choy, Escherichia coli (a bacterium that lives in the human gut and in animal intestines), and so on.
So genomes belong to species, but they also belong to individuals. Every giraffe on the African savanna has a unique genome, as does every elephant, acacia tree, and ostrich. Unless you are an identical twin, your genome is different from that of every other person on earth—in fact, it is different from that of every other person who has ever lived.
Though unique, your genome is still recognizably a human genome. The difference is simply a matter of degree: The genome differences between two people are much smaller than the genome differences between people and our closest relatives, the chimpanzees.
this is interesting vid.
gadionson1 2 months ago
@TheHonestTheist Stats vary widely, but the high number I've seen is that around 46% in the US reject evolution (and many of them don't even know why). The figure for Christians in most other countries is much lower.
papafox 1 year ago
I heard a good way to remember the code is the phrase "Cabury's goodies taste good" but that doesn't work! Maybe "A cadbury good taste"? lol Any suggestions on how to remember?
TheHonestTheist 1 year ago
@papafox most Christians? Most Christians where? Certainly not in the US, where most deny it. I'm not sure of the figures for the UK. Fantatic video though isn't it! Francis Collins being the former head of this project, who I'm sure you know is a Christian. If you want to make a human, just design a factory that can both read all of those books and then assemble complex biological machines :P Can't be that hard right?
TheHonestTheist 1 year ago
@loztheatheist 1 of 3
Did you catch this article?
"Y Chromosome Evolving Rapidly" (ScienceNOW, January 13, 2010)
"As a result, researchers predicted that the Y chromosome SHOULD BE nearly identical in humans and chimpanzees, like the rest of the genome... When the team members compared the MSY sequences, they got a SURPRISE. They found that the chimpanzee Y chromosome has LOST LOTS of genes that are present in humans...
How come they didn't say humans gained these genes?
AA32m7io1 2 years ago
@loztheatheist 2 of 3
The article continues:
"...which suggests the human Y resembles that of the common ancestor MORE than does the chimp's Y. Chimpanzees only have two-thirds of the genes present in the human MSY. But the chimpanzee MSY has acquired twice as many palindromes... The addition of new palindromes in chimpanzees and humans has led to MAJOR STRUCTURAL DIFFERENCES in the Y of both species, the team reported online in Nature today...
AA32m7io1 2 years ago
@loztheatheist 3 of 3
The article concludes with this comment:
"Just when we thought we were getting the sense that we had a pretty good picture of what our genome is like and how it evolved, we get tossed this curve ball," says geneticist Huntington Willard of Duke University in Durham, North Carolina. "There are gems still buried in genomes that we haven't fully uncovered yet."
I just can't wait to see what they find next!!
AA32m7io1 2 years ago
"Evolution caught in the act: Scientists measure how quickly genomes change" (PhysOrg, Jan 1, 2010)
"If you apply our findings to humans, then each of us will have on the order of 60 new mutations that were not present in our parents...Everything that is genetically possible is being tested in a very short period," adds Lynch, emphasizing a very different view than perhaps the one we are all most familiar with: that evolution reveals itself only after THOUSANDS, if not millions of years."
AA32m7io1 2 years ago
@papafox
"1) I describe myself as a non-denominational Christian."
Okay. A) But what specifically makes you a Christian in the first place? B) What do you believe about God and Jesus?
"3) If their dogma conflicts with observed physical reality, then it's their dogma that's at fault, not science."
C) What is your position on miracles? D) Can they be explained by science (i.e., virgin birth, Christ raising Lazarus and Himself from the dead, etc)?
E) What is faith?
AA32m7io1 2 years ago
5) Even if chance is the cause of the physical universe as we understand it, I don't see that as relevant to the existence of God. To me, the two are unrelated topics, in the same way that the rules of French grammar have no bearing on the history of ancient China.
Did God take an active part in "causing" the universe? I don't know, and I'm not particularly concerned about it.
papafox 2 years ago