Upload

Kid History: "Fact!" Episode 4 (True Stories)

BoredShortsTV BoredShortsTV·79 videos
130,397

Subscription preferences

Loading...

Loading icon Loading...

Working...
1,868,370
Like     Dislike 129

Sign in to YouTube

Sign in with your Google Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to like BoredShortsTV's video.

Sign in to YouTube

Sign in with your Google Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to dislike BoredShortsTV's video.

Sign in to YouTube

Sign in with your Google Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to add BoredShortsTV's video to your playlist.

Uploaded on Mar 16, 2011

If our kids wrote our personal history... This is a story about Brett's hard-headedness as a youth. He's absolutely not hard-headed anymore, just ask the referees at his last basketball game. This is a simple story, but as usual the kids come through with the funny.

FACEBOOK.com/boredshortstv
Twitter: @boredshortstv
Store: http://store.boredshorts.tv



Keywords:
kids kid clean comedy funny video fun entertaining hilarious Joke Laugh laughing appropriate entertainment children family humor humour lip syncing sync lol random act acting out stories storytelling "written by a kid" child son daughter mom dad Parents Silly tell telling little young toddler actors actresses story told made up make boys girls youth "make up" writing fairy tale fiction voices creators original polly pockets fact globetrotters oceanology oceanography

  • Category

  • License

    Standard YouTube License

Loading icon Loading...

Loading icon Loading...

Loading icon Loading...

The interactive transcript could not be loaded.

Loading icon Loading...

Loading icon Loading...

Ratings have been disabled for this video.
Rating is available when the video has been rented.
This feature is not available right now. Please try again later.

Top Comments

  • 1Lilly

    Richard is so hot... These guys are so funny

    · 7

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate 1Lilly's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate 1Lilly's comment.
  • Rachel Kydnynok

    All the stars there never were Pumpin cars pumpin gas bumbum

    · 5

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Rachel Kydnynok's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Rachel Kydnynok's comment.

Video Responses


All Comments (1,732)

Sign in now to post a comment!
  • James Sieben

    Every time he says fact I laugh harder then before

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate James Sieben's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate James Sieben's comment.
  • fuzzylilhippiechick

    I hope you guys know how much joy these bring me. I love them. They are so incredibly original. High 5 on keeping us highly amused and delightfully entertained! FaacKT!!

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate fuzzylilhippiechick's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate fuzzylilhippiechick's comment.
  • ImPhoxey

    Please don't talk.

    1:30

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate ImPhoxey's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate ImPhoxey's comment.
    in reply to Nathan Masellis (Show the comment)
  • Fatima Cruzes

    FAAAAAAAAAACCTTTTTTTT!!! Lol

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Fatima Cruzes's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Fatima Cruzes's comment.
  • Avonlea E.

    I agree with you! He reminds me of someone. I just don't know who.

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Avonlea E.'s comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Avonlea E.'s comment.
    in reply to Shyanne Alecia (Show the comment)
  • Avonlea E.

    No, it's true Richard Sharrah IS really cute! Hot even!

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Avonlea E.'s comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Avonlea E.'s comment.
  • Nathan Masellis

    this will be a top comment....FACT!!!!!

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Nathan Masellis's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Nathan Masellis's comment.
  • Willow Harris

    Ffffffffact!

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Willow Harris's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Willow Harris's comment.
  • Charlene Ibarra

    Omg the "dad" is so hot lol his Name is Richard?

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Charlene Ibarra's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Charlene Ibarra's comment.
  • Jersey2tall86

    F-A-C-T!

    ·

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Jersey2tall86's comment.

    Sign in to YouTube

    Sign in with your YouTube Account (YouTube, Google+, Gmail, Orkut, Picasa, or Chrome) to rate Jersey2tall86's comment.
    in playlist BoredShortsTV ALL
  • Loading comment...
Loading...
Advertisement
Loading...
Working...
Sign in to add this to Watch Later