Game Over: Battletech
Loading...
Loading...
11,680
Link to this comment:
Share to:
Top Comments
see all
All Comments (34)
-
On your grave there will be written 'please shit or piss on this grave !'
-
Awwwwwwww Man
-
AGAATGGCGGATGCCCTTATGGTTGAGGAT
GTCGTG (: -
Only thing worse is the Death Duel wall of text.
-
Only thing worse is the Death Duel wall of mockery text.
-
@smoke072 you should see the game over of Raptor - Call of the Shadows
-
Cripes, was that necessary?
-
From a different point of view: "Victory for the Inner Sphere! The Clans have been repulsed! Now we can...go back...to...fighting...each...
other..." -
I like to see that asshole on that screen do better. If he fucks up, then every one can make a mockery of that jerk.
-
*In Austrian accent* Fuck you, asshole!
Loading...
- 1:09Game Over: Death Duelby GameOverContinue9,757 views
- 0:27Game Over: Virtual Bartby GameOverContinue104,248 views
- 0:18Game Over: X-Men (Genesis)by GameOverContinue14,080 views
- 9:12The Evolution Of Mechwarriorby frogjedi411,635 views
- 9:44Mech Assault 2 - Lone Wolf OST - Gladiator Battlesby TheLastHonestGamer2,307 views
- 1:37Game Over: Star Trek - The Next Generation (Seg...by GameOverContinue11,308 views
- 5:06Mechwarrior: Living Legends - Steiner Scouting ...by DarkDragon452gmail17,987 views
- 1:08Catalyst BattleTech tableby tabletopnews5,544 views
- 0:39Game Over: The Punisher (Arcade)by GameOverContinue50,402 views
- 1:24Game Over: Xenosaga Episode Iby GameOverContinue7,959 views
- 0:40Game Over - Hitman 2: Silent Assassinby GameOverContinue12,704 views
- 0:18Game Over: Super Smash Brothers (N64)by GameOverContinue84,549 views
- 0:42Game Over - Hitman: Blood Moneyby GameOverContinue10,529 views
- 0:30Game Over - Hitman Contractsby GameOverContinue6,526 views
- 4:45Game Over - Left 4 Deadby GameOverContinue61,270 views
- 0:16Game Over - Metroid Fusionby GameOverContinue19,616 views
- 0:40Game Over - Super Metroidby GameOverContinue26,805 views
- 0:19Game Over - Metroid: Zero Missionby GameOverContinue31,340 views
- 6:49Classic Game Room HD - BATTLETECH for Sega Gene...by InecomCompany41,043 views
- 2:32Game Over: Chrono Triggerby GameOverContinue15,000 views
How many kids you think this made cry?
OfficialMC2 2 years ago 27
That has got to be one of the cruelest game over screen I ever seen.
smoke072 2 years ago 25