Visualization of chimp and human mitochondrial DNA

The recent publication of the complete chimp genome, marked by a celebratory issue of the journal Nature, tells us that humans and chimps share 96 percent of the same genetic material. This number is hard to comprehend, what exactly does it means to say that we share 96% of our DNA with our closest living cousins?
Directly examining the DNA it self does not help. For example, consider the first 100 base pairs of the chimps mitochondrial DNA:
gtttatgtagcttaccccctcaaagcaatacactgaaaatgtttcgacgggtttacatcaccccataaacaaacaggttt­ggtcctagcctttctattag...

and the first 100 base pairs of the Humans mitochondrial DNA: gatcacaggtctatcaccctattaaccactcacgggagctctccatgcatttggtattttcgtctggggggtgtgcacgc­gatagcattgcgagacgctg...

It is very difficult to gauge similarity, and the full genome for both human and chimp is actually about 3 billion base pairs long!
We have built a simple tool to allow people to visualize and understand the similarity/dissimilarity of DNA sequences. While this work is currently unpublished and still ongoing, we have released a video relating to human and chimp DNA to coincide with the publication of the complete chimp genome.

High res version available at www.cs.ucr.edu/~eamonn/DNA/

Category:

Howto & Style

Tags:

• DNA
• visualization
• mitochondrial
• evolution
• chimp
• chimpanzee
• human

[Rygads]

@smoothpeople33 This post only displays your gross misunderstanding of why these similarities are significant. We did not evolve from apes, we evolved from the same common ancestor that apes evolved from. You won't be genetically identical to your cousin, yet your cousin came from the same grandfather.

[eamonnkeogh]

@MAURYPOVICH84 The music in the video is Chopin - Ballade No. 4 in f minor, Op.52, Andante con moto, performed by Dr. Sang-Hee Lee ( the lady doing the voice over)

[MAURYPOVICH84]

name of song

[rilluma]

i want see a human + chimp HYBRID >:}

[homeschoolingwithaop]

I appreciate the effort here, however, one "turn" in your sequence can significantly change the overall appearance of the result, and does not directly correlate to the actual visual appearance of the DNA strands in nature. Therefore these results can be misleading, especially to the untrained eye. I'm not even certain that this information is useful.

[etcharrison]

@96rorrim You might be interested to know that the pigs DNA are more closely related to human than apes/chimps. also, science reports a new finding ... a human named Ardi who now is heralded as the first human (not luci). science had said that luci was directly descended from apes and now science says Ardi is descended from a questionable source but that both apes and humans diverged from this something. God may give pain to those who show such hatred toward parents.

[OogieBoogie83]

The video doesn't really show much. While I appreciate the effort, you need more then colored lines on the black screen if you want this to be informative for lay people

[OogieBoogie83]

@smoothpeople33

This doesn't prove that your great grand father was a chimp, it proves that great grand father was also a chimps great grand father

[smoothpeople33]

The code for a chimp is 96% LIKE human DNA. This in know way is proof that your great grand father was a chimp. The more similar that an animal is from a human the more I would expect its blueprint to also be similar..

Chimp DNA was passed down from its parents and humans from theirs. Humans are 99.9 % the same other humans and chimps are 99.9% the same as other chimps. This is what DNA shows.

[Flem1337]

@ClearLogicClear Theres splicing of multiple regions which completly changed chromosomes. You need to be sure, not to be comparing an allele which moved due to errors accross million of years.