Firing Thompson M1928A1 Full Auto .45ACP SMG

Firing Thompson M1928A1 Full Auto 45 ACP SMG

Category:

Sports

Tags:

• thompson
• M1A1
• 1928A1
• tommy
• gun
• tommygun
• auto
• ordnance
• 460
• magnum
• 454casull
• casull
• 460magnum
• xvr
• smith
• and
• wesson
• 500
• .50
• caliber
• S&W
• 357
• 44
• revolver
• firearm
• handgun
• weapon
• pistol
• bullet
• 9mm
• .22
• shoot
• shooting
• 40
• 45
• 380
• acp
• ammo
• ammunition
• war
• navy
• army
• marines
• special
• forces
• ak47
• ar15
• m16
• rifle
• .223
• kalashnikov
• bmg
• .308
• 22
• .22lr
• .40
• .45
• 357magnum
• 44magnum
• 223
• 5.56x45
• 5.56
• 7.62
• 7.62x39
• smithandwesson
• seals

[TalibanpizzamaN911]

Why is there a compensator on the barrel and why is it so huge?

[zboyco]

@TalibanpizzamaN911 because our cocks are small

[TheReturningShadow]

I noticed that the shooter appears to be right handed but left eye dominant. That must've taken a bit to get use to the first ever shooting. Can most magazine fed thompson also use drums?

[zboyco]

@TheReturningShadow yea they can use drums

[kp7100]

i want one..oh wait i live in CA. will someone bring reagan back to life so he can say MR BROWN TEAR DOWN THIS WALL. i wanna be a normal gun owner

[Michael71186]

Are you familiar with Thompsons having any kind of jamming issues or firing pin issues? My dad has 2 and one has recently been prone to having the bolt lock up on us and the other has been misfiring due to not striking the primer with enough force. He changed out the springs in both which has not corrected the problems. We have no class 3 dealers in our area so we're trying to resolve the issue ourselves before going through the hassle and cost of transferring them to have them worked on.

[wozjj]

@TalibanpizzamaN911 because when they were first made the gun it kicked up to the right and high so missing the target often. The compensator was to correct this.

[Klainapeda]

I don't See a mag

[PATRONSKiii]

great to use as a .45 semi auto carbine, i'd love to hunt with it, with good JHP bullets

[Tacman556]

RON PAUL, an AD I was pleased to watch.

[richardcatdaddy]

All thompsons are not th same.Some can shoot both stick and drum,other models only stick and not drum.depends on the model.

[zerghalo2]

Hmmmm, I came here to hear TACATACATACATACATACATACATACATA­CATACATACATACATACATACATACATACA­TACATACATACATACATACA, and that's from the 20 round box!

[BOCHUNKS]

Love the Echo......!...Gives you the feeling of being on the receiving end......And you don't sound friendly.

[Electronick7714]

gotta love the tommy gun.



[TheReturningShadow]

@jamzacez I see (no pun intended). Perhaps just practice and training yourself may help, that is if you CAN practice a little more often.