Alert icon
We're changing our privacy policy. This stuff matters.  Learn more  Dismiss

AIRBAG - Comics y Posters

Loading...

Sign in or sign up now!
Alert icon
Upgrade to the latest Flash Player for improved playback performance. Upgrade now or more info.
8,551
Loading...
Alert icon
Sign in or sign up now!
Alert icon

Uploaded by on Jan 27, 2008

Primer single de Alto Disco, el 4º álbum de AIRBAG

Category:

Music

Tags:

License:

Standard YouTube License

  • likes, 2 dislikes

Link to this comment:

Share to:

Top Comments

  • soy argentino, una vez habia escuchado q habia otra banda q se llama airbag y por lo visto es verdad, sinceramente la espoñola esta muchisimo mas buena ya mismo me bajo sus temasss, los de argentina son bastante putitos :S

  • si una española, muy buena

    una argentina, muy mala

see all

All Comments (19)

Sign In or Sign Up now to post a comment!
  • FAASCINAAAAAAAAAAAAAAAAA 

  • el problema es que despues de escuchar ramones, esta banda suena como una tonta copia.

  • es un pequeño detalle al pedo y espero que nadie lo lea XD no esta tocando el bombo XD aj se ve el pie de batero por el agujero y no tiene parche del otro lado jaj XD en fin aguante airbag ! XD AAAAAAAGGGGGGGGGUUUUUUUUUUAAAA­AAAAANNNNNNNNNTTTTTTTTTTEEEEEE­EEE EEEEEEEEEELLLLLLLLLL PPPPPPPPPPPPUUUUUUUUUUUNNNNNNN­NNNNKKKKKKKKK!!!!!!!!!!!!! xD

  • ke asco con este grupo espaniiol tiene voz como ke le estan dando x detras

  • si, los Argentinos son unos flojitos. Los de España son geniales!

  • GABBA GABBA AIRBAG!

  • retiro lo dicho, amgos grupos son muy buenos!

  • me pregunto lo mismo q meltrux¡

    ahy 2 bandas q se llamen airbag??? si lo hay es argentina la banda

Loading...
Alert icon
0 / 00Unsaved Playlist Return to active list
    1. Your queue is empty. Add videos to your queue using this button:
      or sign in to load a different list.
    Loading...Loading...Saving...
    • Clear all videos from this list
    • Learn more