Right Said Fred - What A Day For A Daydream

[RoMTiger1]

HE IS NOT GAY!!! LOOL AS HIS MUSSELS NO GAY PEOPLE HAS GOT SUCH MUSSELS!!!

[xWoodcockx]

@RoMTiger1 he is gay.....google it you tard.

[RoMTiger1]

Penis? *.*

[rredhawk]

Richard is the best baritone in pop music today.

[lensman8]

omg..i never thought I'd see a remake of an old Lovin' Spoonful song !!!!

[PrincessofFrench]

Why do you write always " he is gaaaaay " ? Maybe he's gay, so?

The important is his voice, is it not?

His voice is the best for this song like says "thecooker9"

[Annukka65]

<3

[thecooker9]

I can't imagine better voice for this song.

[vigi86]

wat a hot blonde on 2:38! mmmmhhhhhh....

[Lssnider1]

I was hoping he would sing im too sexy

[meanwiddlekid]

Took a great simple song and made it a steaming pile of over produced crap.

[justinmd1992]

is he gay or some thin in hes song im too sexy he looks gay???????

[ocallzs]

He is too sexy every day, that´s why he is GAAAAAAAYYYY !!!!

[frantowntyson]

Where the hell does he go from 3:29 - 3:31?? a spiral staircase??

[wollf92]

@frantowntyson fock off unoriginal bastard



[frantowntyson]

@wollf92 I have a brother named petunia biiiiiiaaaaaaaaattttttttcccccc­ccchhhhhhhhhhhhhhhhhhhhhhhhhhh­hhhhhhhhhhhhhhhhhhhhhhhhhhhhhh­hhhhhhhhhhhhhhhhhhhhhhhhhhhhhh­hhhhhhhhhhhhhhhhhhhhhhhhhhhh

[johnkenwright]

wow this blows, this song has been totally murdered, and the flash on his teeth - yuck! Had to stop the video. More horrifying than amusing

[Kikadaaf]

@johnkenwright yea.. lovin spoonful version much better

[kaliyuta]

This is so fucking hilarious i'm actually starting to like it.WTf is seriously wrong with me?

[popkarinpop]

ese pata es tan-----------locomia

[interracialvision]

Nice performing and very sexiest girls - who they are? ;)

[VampireAsha]

NO! STOP! THAS GAY! XD

[tannedNgreen]

Can I really dye my eyes to match my tux?

[oOFranCescA2080oO]

he look like dr evil D:

[bigmikeyss23]

I agree why would people think he is gay he is surrounded by sexy women... I mean Ricky Martin was surrounded by sexy women and look how he turned out... oh wait maybe not such a good example

[Rustina61]

Ouch ! My ear hurts just looking at that earring !!

[Rustina61]

Those girls look so unhappy because their arms are tired from being up in the air so long. Bet that burns !!!

[Rustina61]

I wonder what he would look like with hair.

[ag081506]

he has a great sexy voice kkkkkkkkkkkkk

[talha318]

What a day for a ...... I'm too sexy for my shirt too sexy yeaaaaaaaaah.

[kmiutza]

It's really a wonder how he could become so famous since he have such a bad voice (my opinion) :D

[xlerosx]

@kmiutza

Huh?

[sparkelkisses]

His beautiful eyes....OMG!!!!

[newmantbi]

Why everybody says that's hes gay...but in all his videos/.....has the most sexiest girls on the earth?

[Khaos1984]

is he doing this for jokes, lol

[UkerScape]

has he got a dart in his ear? Lol

[joefarthole]

Sad part is, he has an incredible baratone voice. Too bad the music industry AND he himself never took them seriously.

[AceVenturie]

That dude reminds me of a bald gene wilder or that guy from Time Warp

[lovellespice]

so not gay... hehehe

[cooktree]

HILARIOUS!!! God, we can't stop laughing here. The Freds can still carry the humor, milking it for all they are worth! Love it! thanks for putting it on, kudos

[lepampe]

OMG I piss myself!!!

[SuddenSparkles]

How come nobody no care for my beloved Freddy? Does Elm street affair ave sumthin todoo wit it? Frederick is my almost purrfect ten. Eez a 9...

[junnious]

he hassssssssssss a lisssssssssp...doessssssssn't he lookssssss like a musssssscle gay guy.

[jamierbanks0007]

@junnious mutha fucka fuck you!

[junnious]

@jamierbanks0007 thanks mate for your inside observation. take care.

[williampv]

when he sings it seems like he lisps (as if he just got a tongue piercing), yet it goes so good with him singing this song xD

[Stormlady101]

what a great voice I love this song and he makes it sound great

[justmeLars]

catchy

[epsteinsmutha1]

Richard Fairbrass: Whitest teeth any guy ever came across.

[clarencekellerII]

I can't stop watching the cheesiness! It's an awesome though, good for him!

[JASON6567]

0:21 making out with himself

[clarencekellerII]

it's cause he's too sexy for himself!

[JASON6567]

Everyone a mic is on his ear

[RinuTheSwede]

omg, his tooth at 0:16!! So damn funny!

[alexandher2]

ROFLMAO!!!! who comes up with this sht! xD

[neonkodama]

what the HELL is on his ear?!

[alexandher2]

old skool key rings i suppose =/

[JASON6567]

@neonkodama its a mic

[andrew80s]

I think this is great. Great voice and hot babes :)

[MissFonebone]

OMG!

[sntiagol]

very handsome

[TheEvilTwinOfNick]

that was creepy

[Nothegger]

uh the redhead :)

[CissyKitty]

Hilarious :D