Added: 3 years ago
From: cassiopeiaproject
Views: 8,075
Sort by time | Sort by thread (beta)

Link to this comment:

Share to:
see all

All Comments (71)

Sign In or Sign Up now to post a comment!
  • Cerv2 and EBN1 through a spanner in the concept of a Darwin unit.

  • @HackneyEquine " WHY ISN'T LIFE ON MARS? :P"

    Life needs water badly.

  • @HackneyEquine think nasa just found out that has happened.. with life that has replaced phosphorus with arsenic

  • TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG­TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG­TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG­TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG­TTAGGGTTAGGGTTAGGGTAGGGTTAGGGT­TAGGGTTAGGGTTAGGGTTAGGGTTAGGGT­TAGGGTTAGGGTAGGGTTAGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGGTTAGGGTTAGGGTTAGGGTTA­GGGTTAGGG

    sorry for spamming just trying to show my enthusiasm for science :)

  • "mouse into an elephant 10,000 years" ? What about the 50 million year old bat that looks the same as today ? The 50 million year old shark that looks the same as today ? Surley the 125 million year old dragon fly which looks the same today had more then enough time for evolution to work its majic? IOr maybe it forgot those species =p .

  • @yourboycal Evolution does not progress at a stable rate for all populations. Selective pressures must exist on a population in order for there to be a shift in allele frequencies over time.

    If a particular structure does the job, and there is no external pressure to change it, then it will not change.

  • @yourboycal ya i guess evolution forgot to give you a brain oh well at least you'll always have religion right ?

  • @derickhaywood "ya i guess evolution forgot to give you a brain oh well at least you'll always have religion right ? "

    a) i dont subscribe to any religions includinng anti-thiesism. a.k.a athiesm

  • @yourboycal atheism is to religion as bald is a hair colour, as the tv being off is a channel, and as not collecting stamps is a hobby.

  • @yourboycal Evolution isn't a thinking entity. It is a process. And just cause something doesn't "change" over time doesn't mean that evolution isn't happening. It means that those genes are successful. There isn't any reason for them to change, thus they don't. Of course there are also hundreds of changes that we might not even be seeing that could be occurring.

    The problem with your 125 million year old dragonfly is that it looks Similar. That doesn't make it the same.

  • @sabertooth1980 all your doing is psycho analyzing natural selection like creationists psycho analyze god. When it doesnt fit the glove we make up 100's of excuses both sides. ALl your doig is helping prove the ugly side of athiesm more which on the face value of it is nothing more then anti-thiest. Most athiests dont even know what it means to be athiest. They just have anti-thiest views they love to try and destroy. For the open minded fellaw he sees belief on both sides ;)

  • @yourboycal Atheism isn't a religion. Atheists are just as diverse as any other group sharing a wide group of political views and ideals.

    They only share one thing.

    We don't believe in a god. The lack of belief isn't a belief. It is a rejection of a claim put forth by theists.

    This doesn't say what else atheists do believe in. Some believe in reincarnation. Some believe in other supernatural things.

    If telling you the obvious makes me ugly. then so be it.

  • @sabertooth1980 " Atheism isn't a religion. Atheists are just as diverse as any other group sharing a wide group of political views and ideals."

    A crackhead doesnt really consider him a self a crackhead either. Denail is the first step.

    "If telling you the obvious makes me ugly. then so be it."

    Not the obvious just little narrow minds. Filled with scientism ;)

  • @yourboycal Next. Natural selection is a process. It doesn't think, it doesn't breath it doesn't do any of the things that people attribute with a god.

    And I am open minded. I conciser all ideas, but reject false ones.

    lastly. Beliefs are retarded. beliefs are ridged. People will die in the name of beliefs.

    Ideas are far better.Ideas can change. Ideas are fluid.

  • @sabertooth1980 The irony the most ignorant and arrogant are the one who try and cry open mind. You missed the point of the psycho analize though. I would hang up and try your call again...

    People will die in the name of beliefs? Is this your pre convied notion? Do you really think the majority of people would actually die for there beliefs? Of course not because most are double standard hippocrates like anti-thiests ;) dont put all ur eggs in one basket.

  • @yourboycal There are people who will die in the name of their beliefs, and worst of all, there are people who will kill in the name of an ideal or a belief.

    The crusades, witch trials, holicaust, and even what Mow and Stalin did show what fanisim does to a group of unthinking people.

  • @sabertooth1980 "And I am open minded. I conciser all ideas, but reject false ones"

    to filter through false and truth must be quite the talent you have. We should have you up for president 2012.

  • @yourboycal >.> I can't. Remember? Blue laws prohibit Atheists from taking office. However if you want me to be the first Atheist president. I'll take your vote.

  • @sabertooth1980 " I can't. Remember? Blue laws prohibit Atheists from taking office. However if you want me to be the first Atheist president. I'll take your vote."

    Okay lets see how hard it is to be athiest and thiest..

    Okay i believe in god....

    Okay i dont believe in any god...

    Wow one sentence and i've switched sides OMG give him a cracker watson hes solved the case.

  • @yourboycal I'm not going to lie about something like that. I don't have faith, thus I am not going to just tell people that I believe in their choice of god simply to take political office.

  • @sabertooth1980 "I'm not going to lie about something like that. I don't have faith"

    Sure you have faith. In your own belief system w/e it may be. This is my point of anti-thiests vs true athiests. You should realy google the differnce. You will see your not what you thought out to be ;)

  • @yourboycal Faith is believing in something without evidence. I do not have this.

    Anti-thiests. Those who are totally against religion.

    Athiests Those who reject the theistic claim of gods. Any gods.

    I'm waiting for you to get to a point here.

  • @sabertooth1980 "Faith is believing in something without evidence. I do not have this."

    Evidence is in the eyes of the person who interperts the evidence. You already assume there is no evidence from your lack of understanding. This is another byproduct of a narrow mind and scientism. In you view there is no evidence others might see it other wise.

  • @yourboycal Negative. Evidence is testable. Independently verifiable, and demonstrative.

    "scientism" isn't a word.

    If you give me evidence, Testable, independently verifiable, and Empirical Evidence for your case then I am willing to hear you out.

    But if all you have are a bunch of flimsy words, logical fallacies and half truths, Then I am going to give you the same respect I give any other youtube creationist/theist.

  • @sabertooth1980 "I'm waiting for you to get to a point here."

    You didnt have to wait the point was made if you had taken the time to read the answers..

    Anti-thiests totally against the idea of a diety .

    athiest = can see the beauty of the universe without the need of a creator.

    One is filled with ignorance towards just a diety not knowing anything more about the universe nor its possible entrys

  • @sabertooth1980 Cause I don't feel like it and you are more or less a tiny bit of string to play with before really sinking my teeth into something worth while. "

    A tiny bit of string? Was all you could reply with. You wasted my time with this? Good day sir.

  • @yourboycal Yes it is a good day yourboycal.. A GOOD DAY TO SUCK MY COCK.

  • @sabertooth1980 "If you give me evidence, Testable, independently verifiable, and Empirical Evidence for your case then I am willing to hear you out.

    But if all you have are a bunch of flimsy words, logical fallacies and half truths, Then I am going to give you the same respect I give any other youtube creationist/theist. "

    Actually im a philosopher . I dont agree with the creationists nor the anti-thiests. I have beef with both. So please try again.

  • @yourboycal You must have a sore ass from all that fence sitting. Not to mention a stiff neck from navel watching.

  • @sabertooth1980 "You must have a sore ass from all that fence sitting. Not to mention a stiff neck from navel watching"

    Yea takes alot to get around your mama .

  • @yourboycal So you like short old french/italian women? That reminds me, mum said to start washing your junk more often and get yourself tested for VDs.

  • @sabertooth1980 "Now we are moving on to pet names? I didn't think that we were that far into our relationship. Careful, people might start talking about us. "

    Its my friendly gesture for all. To keep the convo bright. Anti-thiests bring out the ugly .

  • @yourboycal This is ugly? I thought this was foreplay. Then again I stopped taking you seriously two days ago.

  • @sabertooth1980 " This is ugly? I thought this was foreplay. Then again I stopped taking you seriously two days ago. "

    Yet still replying =/

  • @yourboycal Unlike you in bed, I can keep this up for the rest of the day.

  • @sabertooth1980 "So you like short old french/italian women? That reminds me, mum said to start washing your junk more often and get yourself tested for VDs"

    Is that what she was? I mistook her for a blue whale.

  • @yourboycal Nope sorry, that was your sister. You need to get your eyes checked.

  • @sabertooth1980 "Yes it is a good day yourboycal.. A GOOD DAY TO SUCK MY COCK. "

    Classic example of anti-thiest. Thanks for proving my point today cupcake.

  • @yourboycal Now we are moving on to pet names? I didn't think that we were that far into our relationship. Careful, people might start talking about us.

  • @sabertooth1980 ' I'm not going to lie about something like that. I don't have faith, thus I am not going to just tell people that I believe in their choice of god simply to take political office. "

    People lie all the time weather they know it or not . Simply tell people that you believe there choice for office what are u ranting about?

  • @yourboycal No. Your last sentence doesn't make much sense. Reword it please.

  • @sabertooth1980 "The crusades, witch trials, holicaust, and even what Mow and Stalin did show what fanisim does to a group of unthinking people"

    This is not for religion its only using religion as its excuse. Kinda like how politicians use liberty freedom and peace as there excuse to continue corruption greed stealing resources etc... all for national securiuty right ? Read between the lines ...look past the mask.

  • @yourboycal Ironic that they need a belief as an excuse to do horrible things. Then again, Ignorance isn't bliss. It's suicide.

  • @sabertooth1980 "No. Your last sentence doesn't make much sense. Reword it please. "

    Why dont you copy paste it first captain obvious as there are numerous sentences ?

  • @yourboycal Cause I don't feel like it and you are more or less a tiny bit of string to play with before really sinking my teeth into something worth while.

  • @HackneyEquine

    Saprophytes were used to describe classes of fungus and bacteria that were thought to be plants before we were able to examine things very well. It was wrong, and has been corrected.

    I'm not offended by criticism. Your criticisms simply aren't valid, nor are they new, original, nor previously unrefuted.

  • @HackneyEquine

    It's a nested hierarchy. Yes, there are concrete branch structures. Insects and mammals are in different branches with no crossover. It's only the branch points themselves that get fuzzy, because there are varying degrees of infertility and variation as a stock population radiates and speciaties. Phylogenetic trees are used because they are accurate.

  • @HackneyEquine

    > When clung-to theories are shown to be incorrect in some way it is either ignored by the community or takes a long time to change over.

    Nope. Pretty much instantaneous there. "Hey guys, a steady state universe shouldn't have uniform cosmic background radiation." "Oh wait, there's some." "Guess we're wrong. Big bang it is!"

    "Hey guys, DNA is more complex than just Mendelian or Darwinism." "Okay, so we're wrong. Fix it to use crossovers and exaptations too!"

  • @HackneyEquine

    Oh come off it. The Darwin-as-religion thing was an old lie when creationists first told it. Now never use that argument again.

  • @HackneyEquine

    Well, quite simply that's because "Darwinism" isn't a religion or a dogma, and Darwin was wrong. *gasp*

    The theory has been corrected as new information comes in about how it actually happens.

  • @HackneyEquine

    Evolution is a change in gene frequency in a population. So if you have a mutation cause a new gene? That's evolution. A meteor wipes out 50% of the non-meteor-resistant genes by killing the animals who have them? Evolution. Guppies who have long tails outbreeding guppies with short tails and making the frequency of long tails go up? Evolution.

  • Evolution is a process. One possible path is through multiple phenotype changes.

    Your question about different blueprints is right on. Natural selection is the process that chooses among the different blueprints that have emerged in the course of life's history. But after that selection has been made, future descendants inherit the one that works the best.

  • Love these videos!

  • 5 Stars!

  • who's down rating these videos? this is brilliant

  • Religious nuts.

Loading...
0 / 00Unsaved Playlist Return to active list
    1. Your queue is empty. Add videos to your queue using this button:
      or sign in to load a different list.
    Loading...Loading...Saving...
    • Clear all videos from this list
    • Learn more