Guitar Hero 2 - Silent Hill 1 Theme

[mangekyou2011]

whats is the name of this amazing and epic song???!!!

[themilousevanhouten]

@mangekyou2011 Silent hill 1 Intro theme ;)

[Swordofswordom]

OH MY GOD HAHAHAHAHA!!! That was friggin hilarious.

[rrod197]

....I want to go play silent hill now...

[Noirepyros]

Where can I find a copy of this song at?

[luissittto]

jajajajajajajajajajajajajajaja­jajaja wow

[noperfectworld7]

does anybody know what kind of genre this song is?is it rock or folk or a combination?i think that it s rock but the mandolin confuses me.

help please...

[max18363]

@noperfectworld7 I would go with rock to be honest. Regardless its still a great tune with a great game.

[FroggyQC23]

@noperfectworld7 Mandolin Hero... that could work!

[STRIDERSPINEL]

@noperfectworld7 i think you could call it just indie rock

[PhantomQueen89]

i wonder why nobody has uploaded this song..it's so beautiful.....well at least i can hear it...thanks!!!!

[tonefresh]

@ResidentEvilSpore oh thanks, a sitar still looks and sounds like a big banjo

[KeikoMagari]

Hey, that's pretty cool. :P

[tonefresh]

wtf?~ the obvious guitar in the very beginning and u play the banjo sounding part???!!

[MegaDragonking123]

Fake you put on the song while you are playing it you no good bullshitter

[PiE2UDie]

@MegaDragonking123 hate to break it to you that its actually REAL :D

[tony282010]

I haven't actually played any GH games but I might if this song is on there. Was this on a hard level or what?

[kittyron]

I didn't know that GH had Silent Hill theme on it!!! awesome

[Igogameshark]

Akira ROCKS!!!!!!!!XD

[john87ofAZ]

Awsome

[Romystic]

This music is awesome, it looks extremely hard on guiter hero lol

would be fun to learn it xD

[TheDasoke]

o_o je n'etais pas au courant que silent hill ait été choisi pour un guitar héro,sa fait chaud au coeur <3

[DTPoe]

Where can I get this song? I've been looking for it and haven't found it...

[billytalent1981]

maby it*s self-made

[DTPoe]

Most probably... I want this song TT-TT... I only find some lame version over the net.

[LegoHarryPotter14]

... This is not even rock o_O it`s horror O_o

[SakuraOfTheSand]

Horror isn't a genre of music. :)

[LegoHarryPotter14]

... or is it?

[LeaTelamon]

No.

[LeaTelamon]

To emphasize, the song isn't quite rock either, it is more closely related to ambience.

[bluerubyvideos]

@SakuraOfTheSand

I think you're forgetting "Friday" and "Baby".

[zeldamusikliebhaber5]

is this realy in guitar hero?!

[nickfaldon]

Ow, that's way is hard

[ClaraRoberson]

w8 i hear another song in the back ground wierd :S

[RudyRocks97]

lol i hear it to its like a beet i guess

[IndalecioCeleste]

Is it a mandolin? It wouldn't matter because Activison thinks EVERYTHING is a guitar apparently, including things that are obviously a keyboard or even a piano.

[OshareHime]

No wonder your right arm was losing energy in the middle of it with all those notes! Still good thought :)

[MHFTeeVee]

this calls for hyperspeed!

[Gamemaniaful245]

keep up the good work

[boethiah12]

actually the intrument in the beginning was a balalaika.

[bagy999]

huh whats that

[OmegaOwA]

No, it is a mandolin.

[boethiah12]

@OmegaOwA

your right. i went back and listened to both instuments. it is a mandolin. lol.oh well it still is a great song.

[Blazerman9000]

you need turbo to play this!

[RainbowxLink]

its weird cuz the instrument at the beginning was a marionette

[HappyPariah]

I believe you are thinking of a mandolin, a marionette is a type of puppet >_>

[uniontown50]

Can somebody please please please just tell me how to put my own music on guitar hero...??? i wanna do it soo bad but i dont know how.

[gioAErgakis]

u need to have it in ur pc or else u cant

[uniontown50]

so you cant do it on a ps2? or ps3? just a computer?

[gioAErgakis]

if u have gh in ur pc in the sing list it says bonus songs and downloads. in ps3 it doesnt as well as ps2. i have it in the wii and it deosnt writes me downloads so its only in computer

[GirlGamerUltmate]

How do you make the song to put in guitar hero

[skaterpeligros]

i like the tactactactatctactatcattcatcatc­tatcatc

[zonauo]

oye eso es posible en gitar hero y como lo isiste?

[theriper18]

a de ser una de las versiones hack del juego, es decir son personas que utilizan un programa para agregar/cambiar las canciones del juego a gusto

[ilovechickens64]

Crazy guitar spin at 1:25 !

[scabberson]

BTW, kudos for making this song. My favorite from all the Silent Hill games.

[scabberson]

Stop writing words. You're disgracing the real English speakers who can express themselves properly.

[MrHaxman123]

deskdraw got PwNZoR3D!!!PwNZoR3D is the worst kind of pwnaege u could get.its PwN3D's brother word but has more action to it.

[Djinnfest]

@scabberson

Quite right. We've no need for you here.

You give beings who possess the capacity for intelligence a bad name.

[spongebobfan14]

you were like in expert right

cuz its so fast

[nclartist]

sweet!!!

[Patatinfernal]

Just wonderful, what more can i say?

[JanettesMyName]

u did great on this game!

[Chinasoversizedclit]

fucking awsome

[StrikerTheLizard]

Learn how to altstrum properly, noob.

[EruLawlliet]

"noob"... does anybody know a nerdier word?

[Doum92]

Stop acting like a fucking douche

He shows this video for people that dont care if he plays well or not so stop acting like a fucking douche thinking that ur good enough to comment people like that.. He only plays for fun so stfu next timeé

[StrikerTheLizard]

bla bla you have a small dick so you talk like that

[Doum92]

I know that u love dick but im not homosexual like u..

Try something smarter next time retard.

[StrikerTheLizard]

Go away. Stop trying to prove something here. The guy playing is obviously quite shit just like you.

[Doum92]

rofl u dont know how ridicukous u look like..go hang urself dumbass.

[StrikerTheLizard]

Yeah I doubt bitches are all over me cuz i look "ridicukous"

Learn to spell motherfucker

[Doum92]

Lol ur only way to looks like superior are with my spelling mistake

That's the proof that i won

[Doum92]

Now stop crying and accept the truth retard.

[StrikerTheLizard]

Get a life loser. While you were talking shit here on youtube I was getting head from my gf

[Doum92]

No..you get a head with your boyfriend because u love penis.

Because im laughing about the biggest retard I've ever seen, I have no life?? Hahahaha that's a good one

[Killerspecwarriors]

You sound like an idiot dude

[doum93]

I love u too

[StrikerTheLizard]

Doum92, just shut up. You're the one who's retarded. "Biggest retard I've ever seen?"

YOU HAVE NEVER SEEN ME!

[doum93]

That's what u think

[Doum92]

Lol a clone!!

[DemoPulchrarum]

looks pretty easy

[khfan654]

i love how the fire shows up and reflects the song...

[MetallicCrayon]

Yeah this is sweet! What version for GH? what system?

[LEINADDANIELHANNA]

this is a oficiall video???

Link to dowload game please!!!!!!!!!

[jeremys8989]

what version of guitar hero 2 BITCH?

this is a blasfemy

is a hacked version shut!

[Killerspecwarriors]

I think the song was downloaded from some page, that's not a hack (from what I now)

[TimeToDieMrBond]

sweet

[Cartman8kyle]

That too cool!

[NewGeneration29]

is it possible to download a virsion like this for guitar hero or rock band

[barbie123123]

omg wat number is this?or is it costom?

[razyel9207]

Not bad for your first try i cannot play this song on this dificullty (yet) im 14 years old u know XD and funnyfurtuson if u sister plays shit its because its bad for guitar hero LOL

[funnyfurtuson]

My sister's playing shit on the ps2 al day long, how do i get her to play nice songs like this one?

[rockchic2009]

what this song called

[rebeccachamberbf]

your better then me i cant even play O_o

[cooldude10136]

i have gitar hero and i can only do medeum difficulty :(

[micio7]

this sing is so cool and its original band is joe romersa and he put words on it and it sounds evil and cool

[VerginaTV]

Why the guitar player is dancing and not playing?

[FamousForMadness]

oh... my... GOD!

This is brill ^_^!

[pwnagebbqftwlol]

is this a real song in the game or is it a custom, cuz if it is real i never seen it

[eirplay]

sweet :)

[19gerike87]

Learn how to play in that game, then you can record this... Aww...

[TimeToDieMrBond]

Oh like you could do any better?

[barbie123123]

u did good for ur first try,5/5 my friend!

[18onurdog1991]

hahaha its fake :p

[WantOxide]

why?

[yodisk]

hey how do you get custom songs on there is it a featre in the game and if so where???

[silentkingdom]

*sigh* Google dude. You need a PS3, XBOX 360, or a PC. And if there is a PS2 way, you have to mod your Playstation

[SilentHillg0D101]

good shit man

some of it looked like it was kicking your ass but you always pulled though!

awsome

cheers

[alakingjoe]

lol! the singer looks like an idiot! didnt sing anything!

[adam26069]

dude lol ur good at this

[IVomitOrgasms]

lol I hope that's sarcasm...I dont really PLAY GH, I just recorded this to show people that mgiht dislike GH's music, that you can download custom songs you might enjoy instead.

I did terrible, and am an average GH player, but I can't resist uploading my talentless playing to show off some of these amazing songs people make for us :D

[Dip370]

Tell me where you can download this song for GH2 or GH3

[eduardo141414]

they're hacks... so u can buy them illegally.......

[XNewDefectX]

Garbage

[Deathmetalisleet]

dude tell me how you got this song now lol

[everkor]

who can insult SILENT HILL

playing the main theme on the F**** GUITAR HERO

[Pietreszcz]

01:10 chaingun xD

[CAwmy]

who can play on this shit?

[DGC211862]

how do u get it dude please tell me i want it =].............nice video 5/5

[rawrorz]

Dude... I'm pure as nub at Guitar hero (didnt play much) That looks freaking hard.. well there are harder songs, but thats hard to me...

[ShannonBaybeeRawr]

yeah stop saying hes bad and he suckss he donee soo good :)

[doomer987]

hey man regarless of what people say even though you know you should not give a fuck what they say you did fucking good man nice shit man hope to see more of these songs

[lifesuxs95]

is this a downloadable song or a mod.

[xXSilentPestilenceXx]

I'm super sure it's a mod.

[masterserraeletrica]

really ?

how do you discovered that ?

genius

[xXSilentPestilenceXx]

I was only answering this guys question.

[STEE1295]

you suck

[DarkVenomKitty]

w00t!!!

[HenrikFelix32]

i love it the best horror game in the world and you are top 1 on this song

[lopido]

resident evil is far better

[XDarkMoleX]

Silent hill is a better horror game then resident evil

[sukasa2]

I have to agree. Resident Evil works almost purely off cheap scares, you know, monsters jumping out of nowhere and making you jump. Silent Hill has some of these, but SH makes a much more successful attempt at mixing visual and audio to create a creepy atmosphere. And if you pay attention to the story, they can throw your head for a trip.

[xxxshanemanxxx]

yeah i never really played SH that much but i always watched my friend play one and two and they are probably the scariest/coolest games ive ever seen. i dont really care for silent hill 3 and 4 though. BTW resident evil games dont even compare to silent hill

[Cheesus333]

That's cause Resident Evail is purely survival horror, whereas Silent Hill is psychological AND survival horror, so it messes with your head more. Like the mannequin room in Silent Hill 3. It's bloody creepy.

[GameManForEver]

HOLY SHIT WE HAVE JUST GIVEN BIRTH TO A YOUTUBE SILENT HILL DEBATE :O HOURRAY FOR HORROR MOVIES!!!!!!! :)

(im serious, horror movies are epic [silent hill is epic])

[littlewiz777]

Don't you mean horror games? Silent Hill games >>>>> The movie

[greyAnGeL27]

TaoJenChan is right, it is called Hometown. It also kinda sounds like the Last Mariachi form Silent Hill4

[narutoanimegirl14]

How can I post SH on my GH?

[snappleisgreat]

dam silenthim was such a had game to beat..the hardest part to me was the piano in the school...that took me days to figure out

[cars887]

the piano was really hard so i had to find a walkthrough

[rianofbullets]

are u shitin me!

[ada0027]

holy shit!

[deathinme06]

can someone let me know how to creat the song and out them in. i want SH in my guitar hero.

[Crovaxx2]

One of the reasons your hand went numb is probably cus you strum too fast ;)

Anyway, nice video.. thanks for sharing!

[miymoto128]

WTF silent hill on GH2 sweet silent hill awesome cool video keep it up 5/5 stars

[annajonz]

is this really on guitar hero 2? ive beathen the whole game all levels of difficulty 100% on ps2 and have never played it. dont strum so fast, dude, find a rhythem, btw. this must be on 360

[urbanzombiekiller]

no.....

you can create custom songs and import them into GH2, it isnt in the game...and no it musnt be on 360, GH2 is on PS2 as well

[ShuyaTheDark]

OMG, what a creation, and speed, that was great

[kojaa]

this IS the silent hill 1 theme.

[lilsteph123456789]

this isnt the silent hill 1 theme. the theme to that game is called theme of laura

[pikpikimon]

It IS called silent hill you dumbass

[lilsteph123456789]

fuck you you skank fucking queer.

[KnifeBloodyNightmare]

you're thinking of the theme song for Silent Hill 2. this is the theme song for Silent Hill 1.

[lilsteph123456789]

i know i totaly realised that after i already posted it so i am here to apologize lol. i wasnt thinking idk. i have the games and i have no idea why but i mixed them all up. Blonde moment i guess. anyways Sorry!!!

[KnifeBloodyNightmare]

lol it happens. so which game was your favorite?

[lilsteph123456789]

well actuAaly it was the second one lol. my second fave was the fourth. i cant wait to play the new ones

[KnifeBloodyNightmare]

haha me too the second one has always been my fave then my second fave is the third one. I still haven't beat the fourth one but it's really different from the rest of the series.

[lilsteph123456789]

I know it kidna almost has nothing to do with any of them. I hadnt played teh second one in a logn long time when i played teh fourth. Then when i plaed the second one again i was freaked out b/c they mentioned walter sullivan in it and i was like hey thats the lkiller from teh fourth. IDK im easliy amused i guess but i thought it was neat

[lilsteph123456789]

i mean is it like they planned it and knew they would make the fourth game or did they just talk bout some guy named walter then many years down the road decided that walter would just seem to make a great killer?

[KnifeBloodyNightmare]

maybe they just ran out of ideas and remembered Walter. and did u notice I think the super's last name is Sunderland or some other person had the name Sunderland I forgot.

[assman1991]

blahblahblah

[NightmareNny777]

Dumbass thats the Silent Hill 2 theme this is the theme for silent hill one get your facts straight

[ABBAskey]

wrong, the song title is officially called homecoming

[NightmareNny777]

Whta do you mean the song title for Silent Hill or Silent Hill 2 because if your talking about SH2 your wrong because its called theme of laura check anywhere maybe your mistaking for the fifth installment for the SH series which is called Silent Hill Homecoming

[TaoJenChan]

You're BOTH wrong. The song title played here is "Hometown" composed by Akira Yamoaka, used in the opening sequence for Silent Hill 1. The Theme of Laura is the opening song for Silent Hill 2. If you don't believe me, look it up on an MP3 download site. And what does the fifth installment of Silent Hill have ANYTHING to do with it? The fifth installment isn't finished yet. NightmareNny777, YOU are the one who needs to get your facts straight before telling somebody else to, because you're wrong

[sumoman25]

actuall you are wrong, hometown is from the game silent hill 3 the one that has voice other than prayer. get your facts right

[TaoJenChan]

I'm always confusing the two. The only real difference between the two is that one has words, you know? *facepalm*

[NightmareNny777]

shit XD!

[NightmareNny777]

I suggest you keep that sharp tonuge behind your teeth no need to start a fight ABBAskey said the theme was called HOMECOMING and the 5th installment is called Silent Hill Homecoming or Silent Hill V jeez

[TaoJenChan]

My point being that you were wrong and refused to admit it. Did I seriously say it was Hometown? I keep getting the two mixed up! They have the same tune, only one has words. -.-

and who said I was trying to start a fight? sounds like fun, though I can assure you those were not my initial intentions. I was stating common Silent Hill knowledge. ;)

[greyAnGeL27]

They obviously do not know much about Silent Hill

[Farenhiet123]

yes silent hill 5 is called homecoming, so the themes will now get mixed up with the game! yay!!

[Effici3nthawk]

ur strumin 2 fast man

[sappyemo3]

ooh..i want to play that song..looks like fun.

[hentairok]

i hear a keyboard

:D

must be emulator

[DLK22]

Guess you never heard of strumming up & down.

[qwertyuewq]

Its just speed picking, any experienced guitarist can do it.

[IVomitOrgasms]

Are you talking to yourself? lol.

That was random. Don't see how a videogame and experienced guitarists are related, but I admire your comment.