Jurassic Park (10/10) Movie CLIP - When Dinosaurs Ruled the Earth (1993) HD

[Jefrma]

funny how this came to me only at being-drunk-point: for all you religious people out there claiming earth is only 6000yrs old, look at that scene with those helpless small humans in front of raptors; are u seriously claiming ppl overruled through that? With just sticks and stones against animals the size of rex? Im sorry but smth here just confumes me, and it aint just the alcohol..

[Geohawk2552]

listen to 1:30 over and over again and see if you can work out what Grant said, it took me a while.

[abassline]

The building must have had doors suited for a T-Rex to enter through.

[bsivoljr]

Fkn TREX comes outta Nowhere

[o13starsnstripes]

Gotta get back to the 90s

[Appaloosalicious1]

2:52 !!!!HAPPY BIRTHDAY!!!!

[marebolgier]

Um dos melhores e mais emocionantes finais que já vi em um filme.

[Kamyu03]

Raptor's face wasssssssssup! xD

[DorianLongstreet]

Do you think this will be part of the tour?

[SuperTalent93]

Look at the raptor's face when he pokes his head through the ceiling at 0:12, he's like "WASSSSSSSUUUUUPPPP!!!"

[AwsumessPrime14]

The T-Rex from the 1st JP is the best female character since Ripley. LOLOL XD

[LizLovesLollipops]

2:47 I LOVE that part

[AX200Z]

2:51. Epicness.

[MrAr54321]

T-rex enters the building through the unfinished side entrance, you can see it at 02:12

[Zlarel]

Humans eyesight must be based on movement. How else did the Rex suddenly appear?

[Madchimpz]

I was just watching Jurassic Park 3 on TV today and I noticed the dinosaurs looked so fake compared to the first 2 Jurassic Park movies.

[andrepets]

It's funny how that t-rex just saves them from the raptors! ;) Wait, was he REALLY saving them??

[MandelaDaKiller]

hmm how did the t-rex enter that small place?

[MrNuubstar]

2:54

the best shot ever

[firedrum71]

Just one question, how the hell did the T Rex get in there!?!?

[AwsumessPrime14]

@firedrum71 On 2:12 you can see right behind the T-Rex, the opening of the building where the T-Rex broke in.

[03bsadful]

saved by that humblest of all gods creatures 2:05

[Firecrow86]

1:47 - "Guys...am I late for the party?"

[Jman5311]

Alan: I have decided not to endores this park.

Me:Damn.

[monsterinyourpocket]

2:48. One of the greatest moments in cinematic history

[deadpassive]

I can't believe how well the special effect stand up 19 years later. I mean... 19 YEARS!

[lenzino7383]

@deadpassive That's because when CGI was first introduced, directors like Steven were using it subtly. They only used it when it was NEEDED and mixed it in with practical effects like the robotics or make-up. CGI now is used so excessively in action movies it's ridiculous. CGI explosions, CGI blood, CGI this, CGI that, it's like watching a cartoon! Smh...

[tauntonbostons1]

This trex can prolly kill a spino

[KaneElite]

1:41 Where da white bitches at?

[oniXlyl]

why do some not see that big opening in the unfinished wall behind the t-rex???

[NewbBOSS]

How did the t-rex get in there? Did it come in the front door or was it too big to fit?

[BlondexKhaos84]

go t-rex! but how the hell did he get in there being so damn big lol

[jaguar4u2012]

1:42

"which is my best side?"

[juggalo2670]

Lol [DINOSAURS RULED THE EARTH!] When T-rex roared! EPIC! ^=3=^

[Andresreddragon1]

0:00 the raptor DNA Codes .

[stefansmith]

The scene from 2:40 onwards is a fantastic example of how Spielberg elevates this movie beyond any generic action flick. Any other film of this kind would just continue to follow the human protagonists on their escape. They got away, what the hell do we care what happens to the dinos, right? WRONG. Spielberg tells the dinosaur side of the T-rex rescue to its conclusion and in doing so creates a fucking EPIC moment (with the help of John Williams and ILM, I should add!). Thank you, Mr. Spielberg.

[gamerboi231]

2:05 epic moment!

[gamerboi231]

the t rex saves the day again!

[FrancoBT3Gene]

That guy is in a Ass-Streak of 4

0:23 and a triple at 0:25

[Jman5311]

The first time I saw this I thought they would die. Thank god T rex ate Raptors!

[aceboy190]

how did they not notice a t-rex right beside them??

[mrclobwein]

Yeah they are cool but scary

[hydras2danewbunch]

6 velociraptors disliked this video.

[AvengingBandit]

@hydras2danewbunch 6 retards actually

[TheJuampilescano]

T Rex Roar translates to english like: I'M THE QUEEN OF THE JUNGLE, BITCHES!

[OmarKarcic]

funny raptor face at 2:01



[bluestreek004]

in the beginning, the letters represent genetic coding sequences. that's neat!

[755hp]

2:46 The skeleton dinosaur that got hit with the raptor must be thinking "well shit; I'm already dead, leave me at peace muthaf@#ker!!"

LMAO at the sound when it got hit!!

[755hp]

Oh God; I LOVE THE 90's!!! TAKE ME BACK!! Born in 1988 and growing up back then was beautiful!

Best decade this country has scene so far!

[natesdevices]

@755hp i was born in 97, HELP ME!!!!

[KaterinaPetrovaPierc]

I dont think they've ever been that happy to see T-rex.

[mrclobwein]

T Rex or raptor

[OmarKarcic]

@mrclobwein raptor

[pokesaurus12]

Epic starts at 0:00 Thumbs up if you agree!

[UndercoverCracker]

2:51.....SO ...FUCKING...EPIC.

[SonicFan0919]

Awesome ending. N'uff said.

[video64ps2]

never ever saw the rex coming when i saw this as a kid but damn i was pumped after that

[BlueBerryFairy1]

T - Rex to the rexcue :D

[Alucardsvamp12]

2:15

YOU BITCH!! HE OWED ME 10 BUCKS!!

[Alucardsvamp12]

1:39

I am back baby!! :) lol

[ZwombieDwog1]

1:10

Raptor: WEEEEE!!! XD

[rsheldon86]

I always thought the DNA code on the raptor's head was coming from the ceiling tiles.

[Penguinmanm]

I always thought it might be cool if in jp3, instead of 'billy brennan' it was tim as an older kid becoming a paleontologist

[bookworm598]

@Penguinmanm that would be cool but if I was tim I would never want to become a paleontologist after almost being eaten by dinosaurs lol

[wildhairwarrior1]

Ok question how they didnt hear the t-rex and how the t-rex fits in that building and how he or she gonna get out?

[99thJediWarrior]

@wildhairwarrior1 Maybe they walk like elephants. Elephants are really quiet when walking.

[TheColorRedpwns]

0:22 Alan is a Ass grab molester. O.O

[legoman123234]

They really should put a "DO NOT CLIMB" sign at the fossils.

[MrAJdude57]

BEST FEMALE FIGHT EVER!!!!!!!

[UndercoverCracker]

@MrAJdude57 Someone hasn't watched Kill Bill.

[MrAJdude57]

@UndercoverCracker Kill Bill is Best female fight for humans, this is the best Female fight in animal kingdom!

[DinaZorz]

@MrAJdude57 Crouching tiger Hidden dragon over Kill Bill any day =]

[MrZillajr]

@MrAJdude57 that isnt a female fight... that t-rex was a male... the t-rex in jp2 was a female.

[RedEmperor17]

@MrZillajr

The rex in JP1 was a female, and there was a male AND a female in The Lost World.

[somethinglacking1]

@MrZillajr All the dinos in JP1 were females. It's explained in the movie.

[optimus304]

@somethinglacking1 but some learned how to change thier genders

[kookilala]

@optimus304 it was the frog dna. they fertilized their own eggs :)

[aztecace]

so jurassic park the game happend after jurassic park 1 cause in the game the t-rex stayed at the visitor center in the game and smashed through the doors but on the movie the doors arnt smashed,and aso at bonoculars you can see their car parked at the tricerotop's habitat.

[PhanDaMan100]

Lol grab that ass

[Penguinmanm]

0:08 grant just made things personal

[fadalisdestroyer666]

Press 6!

[ruotsionpaska]

T-rex has 100 sneak skill.

[anson7900]

2:53 is awesome

[Je9levano]

i was in this movie

[JazzzyWa]

@Je9levano were you one of the miners at the beginning?

[spinosaurus02x]

go rex



[MrCricky1]

T-REX ROCKS

[SauerkrautSandwich93]

2:09 when someone (or something) saves your ass from getting your intestines spilled out, you say: "Thank you"

[joecracknsheeba2]

:11 can i come at the club house!.. WELL DONT KICK ME!

[CPTREX65578]

Whenever i want to see this movie i look up this movie clip because i hate it when people just film there tv.

[dengarassassin]

The t-rex has a stalking mode where it makes as quit foot vibrations as less as possible.

[thedroodxD]

i know a KING made this movie! d-(^.^)-b

[IsSaidLikeThis]

whatd Chuck Norris do? I dont know...

whatd Dr. Alan Grant do? kick a Motherfuckin Raptor

[GogginzOfficial]

This is such an old film, if they could make animation like those creatures look and feel so realistic, then WTF is microsoft and sony doing with their graphics for gaming?!

[ThisLittleAddict]

Um.... This makes no sense, how can he get in, and how can he get out?

I'm trying to make sense a movie about living dinosaurs.....

[TheJurassicStudios]

@ThisLittleAddict: Well, if you look closely at the background, that white covering is how the tyrannosaurus got in. The visitor center was incomplete and the building was haulted with the escape of the dinosaurs on Isla Nublar. Anyway, the t-rex, probably attracted by the noise, came in and attacked the raptors instead of the main characters. Hope I helped you out. :)

[ThisLittleAddict]

@TheJurassicStudios But, that doesn't explain how he came in making no noise. :/

I still love this movies <3

[ArtofGairyuki1]

@ThisLittleAddict you see most animals have thick pads on their feet, mainly the species made for: hunting or migrating. These pads act as cushions blocking out most sounds(for example elephants can move fairly silently due to the thick heel pads) that the animals footsteps would make(unless deliberate...), Since the t-rex was stalking the raptors, she was probably just trying to be as quiet as she could be. Although this doesn't explain how they didn't hear it breathing :/

[ThisLittleAddict]

@ArtofGairyuki1 Well, the t-rex made the water move while walking. :/

[TheJurassicStudios]

@ThisLittleAddict: Well, large predatory dinosaurs, like allosaurus and tyrannosaurus had specially adapted pads on their feet. These would muffle their sounds and prevent mis-steps that would give them away to their prey and rival carnivores. This would normally be used on wooded terrain, but on the flooring, it serves no purpose because the flooring is smooth and makes his foot steps completely silent.

[ThisLittleAddict]

@TheJurassicStudios But the vibrations while walking. Can you explain that? Everyone knows the scene with the water.

[TheJurassicStudios]

@ThisLittleAddict: I actually can. ;) Lol...in the scene where the rex had just escaped and was causing havoc, the rex was hunting, but since her prey, the characters in the film, were either trapped in the cars or stood still so she could not see them and because she already had revealed herself and was seen, there was no need for stealth when it called for power and aggression. Part 1 of discussion, next comment.

[TheJurassicStudios]

@ThisLittleAddict: And when the second water scene, with the water in her footprint, she was at first wandering around her new and extended domain, but when she spotted the people in the car, she went into attack mode and tried to catch the car and snag a few people as a meal, but she wasn't fast enough to catch the 60 mile an hour car and they escaped. What most likely drew her in towards the characters, was all the noise they were making and in real life, tyrannosaurus had excellent hearing.

[MrDoubleKiller]

when i was little i always thought that raptors were trex babies:D

[thegreat144000]

I would have stayed put in the air ducts.

[SauerkrautSandwich93]

they don't even thank the T-Rex after he saves their asses

[TheReviewSquare]

at 2:04 you thought it was over but no!!!!the t-rex came in to save there lives!!!EPIC!!!!

[TargetNumber09]

GACGGAGTCAGTAGCTAGTCGATGCTAGCA­TGCTAGCTAGCTACCGAGATCTATTTCGAT­CTAGCATGCAGACGGAGTCAGTAGCTAGTC­GATGCTAGCATGCTAGCTAGCTACCGAGAT­CTATTTCGATCTAGCATGCAGACGGAGTCA­GTAGCTAGTCGATGCTAGCATGCTAGCTAG­CTACCGAGATCTATTTCGATCTAGCATGCA­

[generation1313]

2:16 Gonzo?

[joel1510001]

How Could No One Notice A T REX Walk Right In??!!! LOL

[123agumon]

@joel1510001 There was a cut scene where the T-Rex comes in through the white tarp. You can see behind the trex the tarp is ripped open and the outside is visible.

[Nabil9404]

@123agumon yes but how did he get in ? the door is too small and the T Rex too big lol

[123agumon]

@Nabil9404 you can see when he bends down, just before the 2nd raptor jumps on his back, that when crouching, the trex could fix through

[axebattler1]

this is not the films original intended ending thats why it makes no sense. spielberg did this because he knew the audience would love it(seeing more t rex) similar to his decision to change the ending of jaws to one that makes no sense but is infinitly cooler

[1084lol]

T-rex saves the day.

[TheReviewSquare]

thumbs up if you think jurassic park is the best dinosaur movie ever better then journey to the centre of the earth and land of the lost for sure :) :)

[warbossgrotsmasha23]

@TheReviewSquare spielberg made his dinosaurs look so life like, so real :D

[99thJediWarrior]

@TheReviewSquare

Best Dinosaur Movies:

Jurassic Park Trilogy

Ice Age: Dawn Of The Dinosaurs

Godzilla (Japanese Godzilla is really a dinosaur)

Disney's DInosaur

Walkign With Dinosaurs

[99thJediWarrior]

@99thJediWarrior Oh and Dinotopia

[pokesaurus12]

@TheReviewSquare Dinosaur movie? Don't you mean best MOVIE ever?

[TheReviewSquare]

@pokesaurus12 yeah buddy :)

[sqccccccccc]

@TheReviewSquare One of the best, for sure!

[TheWolf185]

@TheReviewSquare That's not really saying much.

[starwarsnspiderman30]

uhhh..... HOW THE FUCK DID NO ONE NOTICE THE TREX IN THE MUSEUM? NO 1 GOT PERIPHERAL VISION?

[mattstorm360]

T-Rex NO! if any one is going to eat them its going to be ME!

[sweetchunks22]

dude i would not have the guts to run across a t-rex's eye-view/path like that.. i'd prbly die in there..

[GodofFerrets13]

At the beginning the raptor had a bunch of letters on it's skin for some reason, and they were all T, C, G, and A. Anyone who knows genetics will understand that subtle ironic joke.

[6leggedcow]

Press 8 for some epic dinosaur tossing.

[daniel14bradford]

i love the t-rex

[SplashLurky10]

Rexie's stupid enough to ignore 4 humans in it's face

[pyramidhead138]

@SplashLurky10 well, when you got a raptor jumping all over you tearing away you dont have time to worry about them

[brainy1130]

The raptors killed three out of five people who die in this movie...they almost get the last four, too....they work ever so hard....fiercest and most intellegent dinosaurs ever....and obviously get poned by the rex. :)

[cheezkid]

To this day this movie still gets me choked up and gives me goosebumps... this has always been my #1 favorite movie (along with Jaws) since I was a kid, and I'm 24!! Long live JP!!!

[696trex]

That final roar heralded in the final stage of movie making: being able to make ANYTHING look real.

[godzillaisnuclea123]

this movie is gold, it feels so classy and well made compared to the third which one, the only memorable scene in that was the spino/t rex fight and that is what ruined the movie completely

[georgethehands]

2:45 TAKE THAT YOU LITTLE FUCKER!!!!

[somethinglacking1]

Holy crap, 18 years later and the graphics still hold up. Wish the same could be said for movies these days.

[youkilledmygoldfish]

I love the movie.

[SplashLurky10]

Is the T-Rex INNOCENT, a SAVIOR, or he's doing a REDEMPTION?

[AngusTheWolf]

i always thought that last Raptor had serious balls taking on a T rex

[Tripo1iSamson]

no one noticed the 30 ton t-rex coming in through the front door

[godzillaisnuclea123]

@Tripo1iSamson more like 9 tons

[Tripo1iSamson]

@godzillaisnuclea123 Oh okay. Nobody noticed the "9 ton" T-rex coming through the front door. Asshole.

[godzillaisnuclea123]

@Tripo1iSamson i was joking in a stereotytpical nerd kind of way

[SailorVenus223]

raptor:guys you wont let me in?cause i reeally wanna kill evryone in that room.what are you doing?triyng to reboot the system?Thats not gonna work.

woman:Oh yes it will!

raptor:Oh no it wont!

man:dont encourage her...

[Pitchguest]

I wonder who this TATTTTACCGACAT fellow is, and why his name is tattooed all over that raptor's face.

[lordmomus]

@Pitchguest It's the genome sequence for the creation of the raptor, I guess. It's touched on extensively in the book itself.

[edyoung44]

how the fuck did T-Rex come in with making a sound did it tip toe in there and how did it break the wall without making a sound like i just dont get it but it is an awesome scene like Rexy is the MAN!!!!!!!!!!!!!!!!!!!!

[SplashLurky10]

@edyoung44 There is apparently a section on the building that isn't complete yet, and the T-Rex enter from the unfinished room.

[mrROBOGUTS]

@edyoung44 they prob didnt notice with the fact that there was 2 velociraptors about to attack them

[dannyboyyy1000]

I'm tired of the advertisements. We don't want your shit advertisers, so stop interrupting our programs by promoting your junk. (-_-)

[Nujjitoza]

how the fuck did a t-rex get his ass in there without anyone noticing??

[Googlystube]

@Nujjitoza because nobody expects a T-rex...it's like ninjas. Imagine if you saw a ninja behind you right now. You'd be like "whoa..I never expected a ninja". Same thing...nobody expects a T-rex to appear in their vicinity. You're not looking out for a T-rex right now are you? You could probably see one on the street and think "naw..that can't be a T-rex" and that's their power...like ninjas but more scaley

[Nujjitoza]

@Googlystube "nobody expects a t-rex"

not any more, thanks to this movie

[hermanomedichistes1]

the best pose of the t-rex 2:51

[chrisredfeild100]

how the fuck did that thing get in there

[Penguinmanm]

1:41 hey can i join the party?

[superblobface123]

lol 2:47 fuck u raptor!!

[georgethehands]

I love this film to the max but two things about this scene that baffles me. One is how did T-REX be so stealthy and nobody notice him? and secondly why do they just stand there and look relieved when T-rex attacks the two Velociraptors because I would have been petrified incase he would then turn on me.

[gosthmw2]

2:50 Like A BOWS!!!

[skunkpants]

This film is old, and yet the special effects LOOK and FEEL more real than any film coming out now! This is better made than Avatar for definite!

[Yceb0x]

@skunkpants I've only seen animals this real in LOTR3, amazing how so many films have better special effects back in the day than they do today.

[Burn121212]

2:50 epic

@Burn121212