What altitudes do you get with these bad boys? I'm seriously curious. These are a *long* way away from the little things I lit up with my brother once upon a time...
@KierneM Between 5000 and 6000 feet. They're very fun to make and fly. I wrote a book on how to build the rocket and engine step by step if you're interested. You can find it on Amazon, "I Still Have All My Fingers" Thanks.
@marinskater I wrote a book on how to make the engine and the rocket, it's called "I Still Have All My Fingers" and it's available at amazon. Hope that helps.
Hey brain surgeon...make sure you post the video for all of us to laugh at when the FAA nails that ass of yours for launching high performance hybrid rockets without the use of an FAA waver and range certificate!
@TheAlternateAngle Um...I always get an FAA waiver before I fly so no worries there, I don't need a range waiver because I'm my own club and it's not a hybrid rocket. You might want to Google that. So.....yeah, not so much.
the motors i make are core burning ammonium perchlorate/powdered aluminium/binder but are expensive to make so i cant do it that often, wish i could :(
@ExtremeSilver2000 I wrote a tutorial book on how to make it. You can find it on amazon, it's called "I still have all my fingers" or visit my site inverseengineering dott com
@solidskateboards thanks man just looked at your websight and your vidoes on youtube are great. I look forward to see more of your videos. Got two more questions, do you plan on making another video of the Cayote 2 multi stage cluter rocket? if so will a book be followed?
Holy fricken crap. This has got to be the most EPIC rocket I've ever seen anyone besides like, NASA make. GREAT job. Blast-off was awesome as heck too!
I'd of screamed my head off and would have launched from like, a half mile away in case it blew up and sent some shrapnel my way lol :S
@gr8boyz118 I'm not saying you'd want to have it for lunch. What I meant was that it's relatively non hazardous. You only need agricultural grade, that will work fine.
@gr8boyz118 Very safe, you can eat it. It's used in toothpaste and a variety of other products. The fuel I make is easy and safe. You can drill it, saw it, even hit it with a hammer and it won't lite. You need to get it to 740 deg F before it will light. Very safe.
Oh ye and just a question i bought kno3 and potasium chlorate it sais on safty warnings that it shoudnet be in contact with skin or inhsiled and if swalowwed vomit imeddiatley is this true or just incase like when they say 99.9% on bleach bottles
Right evryone who views this ppllzzzzz help me i mix kno3 and powderd sugar but when it burns it gives of a liquid that then sets even commpressed it gives of no proper thrust i realy dont know what im doing wrong :(
i talked to you once before about your lounch and the boarder patrol, i wanted to know if you made your own engine's and if the formula is 65 grams kno3 ,,,35 grams of sugar and if you used any iron oxide in the formula, i liked your second rocket you know everybody love's round strate rockets, did you use a cement nozzel and what did you plug the other end with epoxie? and did you use a washer in the nozzel, was the fuel cooked or dry?
@carpepotentia The K500 in my book produces 2273 Ns, the total engine weight is 8.30 lbs. The engine casing weighs 2.65 lbs, the rest is fuel. Hope that helps.
@solidskateboards hey, could you email me the blueprints too? MY email is andy70707 [AT] gmail [DOT] com. I would be interested in making a rocket like yours, or maybe a scaled down version. Could you post a video on how you make the fuel too? I can never get it right. I am currently using pure kno3+sugar, but even when made correctly, my rocket barely goes more than 5 metres. Do you use sorbitol instead of sugar or anything? It may also be because my cooker isn't temperature controlled.
Hi Guys, cool stuff. But I think your parachute issues may be tied to your apogee detection logic. Note that everything in the rocket is in a “freefall” (weightless) the instant the engine quits; not only at apogee! I suspect that your parachute pops only after the rocket falls fast enough to reach terminal velocity during the fall back. That’s the moment when the sensor could detect gravity; then pops the chute late.
Oh, and if you want a more complicated design, what if you timed the booster engines to come off and parachute down, that way they don't get ripped off and cause the rocket to go batshit insane.
Please tell me. If I add corn syrup to the KNO3&sugar mixture and mix it all together, would it make the fuel as flammable as it was? And what if I can't find corn syrup, what can I use instead? I want to be able to make fuel cells to add from one to three, depending on my needs. I appreciate your help!
Hi, please tell me. If I add corn syrup to the KNO3&sugar mixture and mix it all together, would it make the fuel as flammable as it was? I am just compressing the mixture into the tube and it's as good as it is when coocked. And what if I can't find corn syrup, what can I use instead? I want to be able to make fuel cells to add from one to three, depending on my needs. I appreciate your help!
Well it's a little more complicated than that. You need to mix them in the right ratio or your fuel won't burn. You can use Lyle's Golden Syrup if you're in the UK or you can Google how to make corn syrup on your own. It's pretty simple. You can also purchase the book "K450 PVC Rocket Engine" on Amazon or inverseengineering and it will explain exactly how to do it step by step.
You can find a book on how to make the engine at my website, inverseengineering or amazon the book is called K450 PVC Rocket Engine. I know, not the most creative title but oh well.
Thanks, please being possible insert caption because my english not very good, rsrs sorry... thanks a million... en congratulations, your work is simply fantastic!!! what do you use propellant ? kno3 or ammoniun?
Gracias, i se alegra le gustan los videos. Yo uso nitrato de potasio y azúcar empolvado y jarabe de maíz para hacer el combustible. Es muy fácil y seguro.
Thank you, i am glad you like the videos. I use potassium nitrate and powdered sugar and corn syrup to make the fuel. It is very easy and safe.
Corn syrup makes the fuel flexible so it won't crack and explode. You can find instructions on how to build the engine in "Build it Yourself K450 PVC Rocket Engine" available on my site, inverseengineering or amazon. Thanks.
@solidskateboards why did the copcar come? is it illegal to have rockets? i imagine if u want to use them in a badway, but then again,u can even use a kitchen nife or a pencil in a bad way.. :(
nice, im gonna launch another rocket in a few weeks with an 8-cluster of black powder tubes timed with time fuse around the main engine, and a video camera. What software did you use to design the rocket? I have been looking for something to create blueprints like that for ages but I am stuck with fireworks CS4, drawing them by hand. Also, are you gonna post a video on how to make the fuel? Is it just KNO3+sugar (recrystallized) or KNO3+sorbitol or dextrose or something else?
Good luck with your launch! I use TurboCAD by IMSI for the drawings. It's cheaper than AutoCAD and easier to use for what I do. I wrote a book on the fuel which is available on Amazon or my site inverseengineering. It's not recrystallized, it's Kno3, powdered sugar and corn syrup. The corn syrup makes it flexible so it won't crack under pressure. You just heat it up in an electric wok to lower the viscosity and then pour it into the casing, easy.
what i want to know is if i can put a few of these rockets on my moped during the straight away on the race track, cuz its uphill and my mopeds slow =D
So what did the Border Goons want? Did they stick around to enjoy the show? Here in Az it's hard to find the BP on the border where they belong. They like to harass American citizens at checkpoints.
Go to the website at the end of the video for complete information on how to construct the engine and the fuel. The fuel is melted and poured into a 2" PVC casing with a cement nozzle.
Don't bother to reply to these noobs. Let them learn how to use google.
Yeah, I miss rockets. The good, sweet smell of molten KNO3 and sugar all over my house.........uhhhh....the good ol' days.
Although, I was never as professional as to construct a welded launch guidance, nor actually make the rocket bodies with fins. I basically shot 2-3lb motors tied to a stick....but they flew far, nevertheless.
From the FAA website: * An amateur rocket must be: * Launched on a suborbital trajectory, * Unmanned, and * Not cross into the territory of a foreign country unless there is an agreement between the United States and the country of concern.
Lol the guy in the border patrol plane:
"Nah HQ it just looks like they're having a nice walk in the des- HOLY FUCK! HOLY FUCK!"
ubudog32 2 weeks ago
What altitudes do you get with these bad boys? I'm seriously curious. These are a *long* way away from the little things I lit up with my brother once upon a time...
KierneM 2 weeks ago
@KierneM Between 5000 and 6000 feet. They're very fun to make and fly. I wrote a book on how to build the rocket and engine step by step if you're interested. You can find it on Amazon, "I Still Have All My Fingers" Thanks.
solidskateboards 2 weeks ago
@marinskater I wrote a book on how to make the engine and the rocket, it's called "I Still Have All My Fingers" and it's available at amazon. Hope that helps.
solidskateboards 1 month ago
@marinskater 1200 pounds is way too much, you won't be able to control the thrust. Keep us updated!
solidskateboards 1 month ago
I only want to say that this idea seems to me brilliant!, I think it should work, it only needs a little more improving!
rodriaereo 2 months ago
@rodriaereo Thanks!
solidskateboards 2 months ago
Hey brain surgeon...make sure you post the video for all of us to laugh at when the FAA nails that ass of yours for launching high performance hybrid rockets without the use of an FAA waver and range certificate!
TheAlternateAngle 3 months ago
@TheAlternateAngle Um...I always get an FAA waiver before I fly so no worries there, I don't need a range waiver because I'm my own club and it's not a hybrid rocket. You might want to Google that. So.....yeah, not so much.
solidskateboards 2 months ago 5
I really think you should prefect this bad boy, because this thing looks bad ass!!!!
ExtremeSilver2000 3 months ago
@ExtremeSilver2000 Thanks!
solidskateboards 3 months ago
What about the first shot? Didn't you retrieve that one?
Barnekkid 3 months ago
@Barnekkid Only part of it.
solidskateboards 3 months ago
Didnt the police arrest you for being terrorist?
2012goingNutz 3 months ago
@2012goingNutz Yes, all the time.
solidskateboards 3 months ago 3
meanwhile at the white house.... MR PRESIDENT! WE HAVE DETECTED A MISSILE LAUNCH! President: ........launch the nukes
hifeyracer 3 months ago
Yeah its somewhere in mexico
ASTROgraffitiology 3 months ago
Any Idea where 1 can find detailed plans for the apogee detector ?
tahamonie 4 months ago
@tahamonie There are detailed, step by step instructions in my book 'I Still Have All My Fingers' available on amazon dott com. Good luck!
solidskateboards 4 months ago
Now THAT is an air show!
Magabury 4 months ago
the motors i make are core burning ammonium perchlorate/powdered aluminium/binder but are expensive to make so i cant do it that often, wish i could :(
Unguidedone 4 months ago
What happened with the police?
origindirewolf 4 months ago
@origindirewolf They just wanted to check it out. None of this is illegal.
solidskateboards 4 months ago
great but how make it
MrSalehsalem 4 months ago
@MrSalehsalem I wrote a book on how to make it called 'I Still Have All My Fingers' you can find it on amazon dott com
solidskateboards 4 months ago
Hey man if you ever decied to make another one can you can you make instructional video how to make a roket with a PDF file would be amazing!
ExtremeSilver2000 5 months ago
@ExtremeSilver2000 I wrote a tutorial book on how to make it. You can find it on amazon, it's called "I still have all my fingers" or visit my site inverseengineering dott com
solidskateboards 5 months ago
@solidskateboards thanks man just looked at your websight and your vidoes on youtube are great. I look forward to see more of your videos. Got two more questions, do you plan on making another video of the Cayote 2 multi stage cluter rocket? if so will a book be followed?
ExtremeSilver2000 5 months ago
@ExtremeSilver2000 Thanks, glad you like it. No, I'm sort of done with that design.
solidskateboards 4 months ago
I tried to make one before and just did nothing the Kno3 never lit. I always wanted to make another one!
ExtremeSilver2000 5 months ago
This rocket KnO3 powered only?
seldian 5 months ago
@seldian Yes
solidskateboards 5 months ago
Holy fricken crap. This has got to be the most EPIC rocket I've ever seen anyone besides like, NASA make. GREAT job. Blast-off was awesome as heck too!
I'd of screamed my head off and would have launched from like, a half mile away in case it blew up and sent some shrapnel my way lol :S
SSRenegade151 5 months ago
@SSRenegade151 Thanks!
solidskateboards 5 months ago
Right well
Im gettin the book then :) lol
gr8boyz118 6 months ago
@gr8boyz118 Good luck, let me know how your project turns out!
solidskateboards 6 months ago
But u can only eat food grade right
gr8boyz118 6 months ago
@gr8boyz118 I'm not saying you'd want to have it for lunch. What I meant was that it's relatively non hazardous. You only need agricultural grade, that will work fine.
solidskateboards 6 months ago
Is potasium nitrate safe on skin
gr8boyz118 6 months ago
@gr8boyz118 Very safe, you can eat it. It's used in toothpaste and a variety of other products. The fuel I make is easy and safe. You can drill it, saw it, even hit it with a hammer and it won't lite. You need to get it to 740 deg F before it will light. Very safe.
solidskateboards 6 months ago
Oh ye and just a question i bought kno3 and potasium chlorate it sais on safty warnings that it shoudnet be in contact with skin or inhsiled and if swalowwed vomit imeddiatley is this true or just incase like when they say 99.9% on bleach bottles
gr8boyz118 6 months ago
@gr8boyz118 I use Potassium Nitrate, not Potassium Chlorate. Sorry, don't know much about it.
solidskateboards 6 months ago
I whas thinking of a 3 inch long rocket is this one like a metre
gr8boyz118 6 months ago
@gr8boyz118 once you know how to make the fuel you can make a rocket any size.
solidskateboards 6 months ago
Is easy to do because im only 12 and im in the uk
gr8boyz118 6 months ago
@gr8boyz118 It's pretty easy but you might need some help with some of it. It's a good project to do with your dad.
solidskateboards 6 months ago
Right evryone who views this ppllzzzzz help me i mix kno3 and powderd sugar but when it burns it gives of a liquid that then sets even commpressed it gives of no proper thrust i realy dont know what im doing wrong :(
gr8boyz118 6 months ago
@gr8boyz118 Check out my book on amazon. It's called "I Still Have All My Fingers" and it shows how to make the complete rocket including the engine.
Dan
solidskateboards 6 months ago
3:13 thats what she said
traceradam 7 months ago
now make it 500 feet tall and ull get to space
beaniebrothers1 7 months ago 9
@beaniebrothers1 Redo that design.
hellzone100 5 months ago
i talked to you once before about your lounch and the boarder patrol, i wanted to know if you made your own engine's and if the formula is 65 grams kno3 ,,,35 grams of sugar and if you used any iron oxide in the formula, i liked your second rocket you know everybody love's round strate rockets, did you use a cement nozzel and what did you plug the other end with epoxie? and did you use a washer in the nozzel, was the fuel cooked or dry?
david1513 8 months ago
whats tanks got to do with an air show?
Defaultbomb11 8 months ago
what did the cop say
jonmclovin 8 months ago 9
@jonmclovin Just wanted to watch.
solidskateboards 8 months ago
@solidskateboards How many Ns/g have your engins ?
carpepotentia 7 months ago
@carpepotentia They have 2273 Newtons. I'm sorry I don't know what Ns/g is. Newtons per gram?
solidskateboards 7 months ago
@solidskateboards Yes thx. Well, I'd like to know the capacity of your engines related to the complete weight of it.
I've got an engine class F, capacity is 54 Ns, weight 180 g, makes 0,3 Ns/g.
I'd like to thank you for your information.
carpepotentia 7 months ago
@carpepotentia The K500 in my book produces 2273 Ns, the total engine weight is 8.30 lbs. The engine casing weighs 2.65 lbs, the rest is fuel. Hope that helps.
Dan
solidskateboards 7 months ago
@solidskateboards whats your ratio of kno3 to sugar?? XD
xSuperAssassinx 7 months ago
@xSuperAssassinx 65/17/18 I use corn syrup as well as sugar.
solidskateboards 7 months ago
@solidskateboards thanks XD
xSuperAssassinx 7 months ago
it went to the moon!!!!!!!!!!!!!!!!!!!!!
Ponchovillla14 8 months ago
Tip for the next time, use a tripod. Besides that... AWESOME JOB!!!
butaangas 8 months ago
@butaangas Thanks!
solidskateboards 8 months ago
whats the music at 1:10?
jurciks71 8 months ago
@jurciks71 Beastie Boys
solidskateboards 8 months ago
Great work! Can you please provide instruction in how I can get a parachute to deploy? Cause I have absolutely no idea.
vlad781 9 months ago
@vlad781 I sent you a message on your channel.
Dan
solidskateboards 9 months ago
@solidskateboards please try again, it didnt show up
vlad781 9 months ago
@vlad781 email me at dan@inverseengineering com
solidskateboards 9 months ago
Comment removed
vlad781 9 months ago
@solidskateboards Ok, i have sent out an email, regarding my initial question.
PS: I recommend you delete the previous comment with your email to prevent spam.
vlad781 9 months ago
second is much better! why are theese electronics needed? :o
how to add the parachute?
ReinisDebners 9 months ago
@ReinisDebners There were two stages, they needed to be ignited at different times. That's what the electronics were for.
solidskateboards 9 months ago
second is much better! why are theese electronics needed? :o
ReinisDebners 9 months ago
@ solidskateboards what did the cops want, or border patrol who ever thay were?
david1513 9 months ago
They were just checking what was going on. The launch site is about 100 yards from the Mexican border so they're always there.
solidskateboards 9 months ago
What measurements are you talking about? The engine? Nozzle? Fuel?
solidskateboards 10 months ago
how cool is this ... beastmode
SITHDRAGOON 11 months ago
1:08 - 1:37 = what they sell at the local Russian Wal-Mart
zephlid6 1 year ago
@zephlid6 they sell alrm clocks too
jamesracek88 11 months ago
Comment removed
YourADrag 1 year ago
well would you consider the bigger problem of flying at higher altitudes controlling the rocket's direction?
panoulis20 1 year ago
I was just saying it could be done. I'm happy flying at 6000'
solidskateboards 1 year ago
whats the biggest altitude your rocket could get to using kno3 and sugar mixure fuel?
panoulis20 1 year ago
My current rocket, which has 4 lbs of fuel in it, goes to 6000' Higher altitudes would be easy, just scale up.
solidskateboards 1 year ago
love it, love it nice design and concepts and testing ....................good job
cannonmaster1 1 year ago
Thanks!
solidskateboards 1 year ago
which software do you use to make the blue prints?
2129261184 1 year ago
IMSI TurboCAD
solidskateboards 1 year ago
@solidskateboards Have to check it out.
I´m using SolidWorks at the moment.
2129261184 1 year ago
Comment removed
brushybillguide 1 year ago
@solidskateboards I have used Turbocad Pro for about ten years.
Great software. Great video and rockets, and you got to take one home!! thanks for posting.
brushybillguide 1 year ago
3:14
That's what she said!
noxnflame 1 year ago
my email:
aliamne@yahoo.com
thanks again..
MrPersiaTV 1 year ago
send me your email address and I'll send you a PDF of the rocket
solidskateboards 1 year ago
@solidskateboards
Hey Dan, Please send it to me too ..
I also tried to download all the videos you've :)
Thank you very much.
MrPersiaTV 1 year ago
I'll need your email.
solidskateboards 1 year ago
@solidskateboards hey, could you email me the blueprints too? MY email is andy70707 [AT] gmail [DOT] com. I would be interested in making a rocket like yours, or maybe a scaled down version. Could you post a video on how you make the fuel too? I can never get it right. I am currently using pure kno3+sugar, but even when made correctly, my rocket barely goes more than 5 metres. Do you use sorbitol instead of sugar or anything? It may also be because my cooker isn't temperature controlled.
brainiac777 1 year ago
Sure.
solidskateboards 1 year ago
Hi Guys, cool stuff. But I think your parachute issues may be tied to your apogee detection logic. Note that everything in the rocket is in a “freefall” (weightless) the instant the engine quits; not only at apogee! I suspect that your parachute pops only after the rocket falls fast enough to reach terminal velocity during the fall back. That’s the moment when the sensor could detect gravity; then pops the chute late.
givemetoast 1 year ago
Thanks for the comment! We did eventually get it working right, check out the video "finally everything works perfectly, twice in one day"
solidskateboards 1 year ago
Wonderful flight.
dcox01 1 year ago
This has been flagged as spam show
It ain't rocket science. Oh, wait...
zhmapper 1 year ago
always wondered about a gyro of some sort to help with keeping flight on path
MON383 1 year ago
Is that an audible sonic boom?!
Dragonsintuxcedos 1 year ago
@Dragonsintuxcedos No, its the second stage engine.
Chromedome77 1 year ago
Oh, and if you want a more complicated design, what if you timed the booster engines to come off and parachute down, that way they don't get ripped off and cause the rocket to go batshit insane.
KittyRokher 1 year ago
Oh shit, man. Where'd that thing go?
Needs more stability, but, I'm not very educated in rocketry so feel free to ignore me :D
KittyRokher 1 year ago
Please tell me. If I add corn syrup to the KNO3&sugar mixture and mix it all together, would it make the fuel as flammable as it was? And what if I can't find corn syrup, what can I use instead? I want to be able to make fuel cells to add from one to three, depending on my needs. I appreciate your help!
ParaglidingManiac 1 year ago
Hi, please tell me. If I add corn syrup to the KNO3&sugar mixture and mix it all together, would it make the fuel as flammable as it was? I am just compressing the mixture into the tube and it's as good as it is when coocked. And what if I can't find corn syrup, what can I use instead? I want to be able to make fuel cells to add from one to three, depending on my needs. I appreciate your help!
ParaglidingManiac 1 year ago
Well it's a little more complicated than that. You need to mix them in the right ratio or your fuel won't burn. You can use Lyle's Golden Syrup if you're in the UK or you can Google how to make corn syrup on your own. It's pretty simple. You can also purchase the book "K450 PVC Rocket Engine" on Amazon or inverseengineering and it will explain exactly how to do it step by step.
solidskateboards 1 year ago
I was thinking a lot about Kno3/Sugar fuel. Know I just need to find out how to make a simple rocket engine that will convert that power into thrust.
ParaglidingManiac 1 year ago
You can find a book on how to make the engine at my website, inverseengineering or amazon the book is called K450 PVC Rocket Engine. I know, not the most creative title but oh well.
solidskateboards 1 year ago
lol my alarm sounds just like that...
Mrblahblah101101 1 year ago
the best thing to do, is put 5 grenade in that rocket and change it into a ballistic missle and chase after that plane
quangluu96 1 year ago
ummmm........ wow.
mlacey56 1 year ago
Thanks, please being possible insert caption because my english not very good, rsrs sorry... thanks a million... en congratulations, your work is simply fantastic!!! what do you use propellant ? kno3 or ammoniun?
fotodariodias 1 year ago
Gracias, i se alegra le gustan los videos. Yo uso nitrato de potasio y azúcar empolvado y jarabe de maíz para hacer el combustible. Es muy fácil y seguro.
Thank you, i am glad you like the videos. I use potassium nitrate and powdered sugar and corn syrup to make the fuel. It is very easy and safe.
solidskateboards 1 year ago
@solidskateboards what are the ratios?
never heard you can use corn syrup :o
WebShareMusic 1 year ago
Corn syrup makes the fuel flexible so it won't crack and explode. You can find instructions on how to build the engine in "Build it Yourself K450 PVC Rocket Engine" available on my site, inverseengineering or amazon. Thanks.
solidskateboards 1 year ago
@solidskateboards I never had an explode result, My rockets almost allways turn out to be smokebombs-.-
Tho i dont have access to melt my mix, i use dry mix without corn syrup, and it burns slow :(
WebShareMusic 1 year ago
@solidskateboards why did the copcar come? is it illegal to have rockets? i imagine if u want to use them in a badway, but then again,u can even use a kitchen nife or a pencil in a bad way.. :(
omarfaw 1 year ago
very good man... From the Brazil
fotodariodias 1 year ago
Thanks!
solidskateboards 1 year ago
very good man...
fotodariodias 1 year ago
border patrol's like WTF?
drewb1994 1 year ago
nice, im gonna launch another rocket in a few weeks with an 8-cluster of black powder tubes timed with time fuse around the main engine, and a video camera. What software did you use to design the rocket? I have been looking for something to create blueprints like that for ages but I am stuck with fireworks CS4, drawing them by hand. Also, are you gonna post a video on how to make the fuel? Is it just KNO3+sugar (recrystallized) or KNO3+sorbitol or dextrose or something else?
brainiac777 1 year ago
Good luck with your launch! I use TurboCAD by IMSI for the drawings. It's cheaper than AutoCAD and easier to use for what I do. I wrote a book on the fuel which is available on Amazon or my site inverseengineering. It's not recrystallized, it's Kno3, powdered sugar and corn syrup. The corn syrup makes it flexible so it won't crack under pressure. You just heat it up in an electric wok to lower the viscosity and then pour it into the casing, easy.
solidskateboards 1 year ago
Which Airshow was that one????
RikTap 1 year ago
It was the Miramar Air Show in San Diego.
solidskateboards 1 year ago
You are a brilliant man!
pevargas 1 year ago
Thanks dude!
solidskateboards 1 year ago
What was the altitude? By the delay of the sound coming from the second stage it must have gone up a ways.
AVincent2 1 year ago
We never found it but it seemed like it was up there a ways.
solidskateboards 1 year ago
@solidskateboards about 3400+ Ft... o.0
LikeAVideo 1 year ago
Thanks, I did put a camera on some later flights. Check my channel.
solidskateboards 1 year ago
'so where driving back with a rocket in the back... i feel so dirty!' lol
ViperEcho14 1 year ago
border patrole plane. yeah actually we strapped alot of mexicans on it and desided to send them back? did that make sence?
shidoink 1 year ago
Was that a sonic boom when the second stage fired?
ntczdw 1 year ago
I think it was the second engine starting
solidskateboards 1 year ago
put a fucking video camera on the rocket or parachute cuz you can get real time images from the ground and create some sort of yaw control. idiots!
9DragonMaster 1 year ago
what i want to know is if i can put a few of these rockets on my moped during the straight away on the race track, cuz its uphill and my mopeds slow =D
9DragonMaster 1 year ago
SSSSAAAAAAABBBBBBBOOOOOOTTTTTTTTAAAAAAGGGGGGGGEEEEEE!!!!!
LOL ... awesome ...
ohmannhey 1 year ago
The latest rocket was the best ive ever seen
Btw what happend when the police came?
MorsamMosa 1 year ago
Thanks, they just wanted to see what was up. No big thing.
solidskateboards 1 year ago
Sweeeeeeet!
eggaweb 1 year ago
that must have made the BP happy
Double0eleven 1 year ago
So what did the Border Goons want? Did they stick around to enjoy the show? Here in Az it's hard to find the BP on the border where they belong. They like to harass American citizens at checkpoints.
TalksWithDirt 2 years ago
They were cool.
solidskateboards 2 years ago
Extra weight near the exhaust with all those engines, you needed to either weight the tip or extend the length, that will help with balance.
Shado8888 2 years ago
Keep up the good work!!! If you could you should put a camera on that 2 stage rocket!! 5 stars!!!
Kellyrt 2 years ago
what is your propellant mix/ratio?
OCDADVENTURES101 2 years ago
65/35
solidskateboards 2 years ago
@solidskateboards, just dry mix?
OCDADVENTURES101 2 years ago
Go to the website at the end of the video for complete information on how to construct the engine and the fuel. The fuel is melted and poured into a 2" PVC casing with a cement nozzle.
solidskateboards 2 years ago
Don't bother to reply to these noobs. Let them learn how to use google.
Yeah, I miss rockets. The good, sweet smell of molten KNO3 and sugar all over my house.........uhhhh....the good ol' days.
Although, I was never as professional as to construct a welded launch guidance, nor actually make the rocket bodies with fins. I basically shot 2-3lb motors tied to a stick....but they flew far, nevertheless.
5 stars for the vid!
dawson01912 2 years ago
This is awesome! Is there any regulations as to where you can launch these types of amateur rockets?
mackgren 2 years ago
You need the land owners permission and it obviously needs to be a safe distance away from anyone or anything.
solidskateboards 2 years ago
the cops just wanted to watch i didnt think this was legal i thought you would need a stupid nasa permit or something lol.
williepie 2 years ago
Actually they weren't cops, they were border patrol agents. It's perfectly legal to build and launch amateur rockets
solidskateboards 2 years ago
how big do they consider "amateur"?
williepie 2 years ago
From the FAA website: * An amateur rocket must be: * Launched on a suborbital trajectory, * Unmanned, and * Not cross into the territory of a foreign country unless there is an agreement between the United States and the country of concern.
Other than that, as big as you want.
solidskateboards 2 years ago
sweet now all i need to do is find somewhere to launch i live in a forresty place dont want fires )=
williepie 2 years ago
That's the trick.
solidskateboards 2 years ago
That was bad ass..... lol i can only guess the pilots expression if had he been within visual range lol
redfirekla 2 years ago
Are you only using Kno3/sugar as Fuel and how many seconds does it burn?
MemberMan080 2 years ago
Kno3, Sugar and Corn Syrup. The K450 Engine burns for 2.5 seconds and has a peak thrust of 300 lbs.
solidskateboards 2 years ago
wow awesome... what happened with the cops??:D
komandercody 2 years ago
Thanks, they just wanted to watch.
solidskateboards 2 years ago
if you had the money, couldn't you do something with gps to lokate you rocket. That is once you're sure the rocket wil come down in one piece.
Sorry i'm dutch so my english isn't great
But you make the greatest videos!
the2smoke2fire 2 years ago
Thanks! For me the fun is making the rocket with easy to get, inexpensive parts. Yes, a GPS system would be fantastic, maybe in the future!
solidskateboards 2 years ago
that first rocket was awesome.. keep up the good work...
redliquid33 2 years ago