Added: 3 years ago
From: DonExodus2
Views: 91,973
Sort by time | Sort by thread (beta)

Link to this comment:

Share to:
see all

All Comments (3,692)

Sign In or Sign Up now to post a comment!
  • There is another aspect of religion of the Bible than Judaism/Christianity&excisted in various cultures into the 20th century First in the Bible In Genesis Adam thru to Abraham&really to Moses Job in the book of Job lived centuries before Abraham but had the same God Cornelius in the book of Acts was neither Jew/Christian nor pagan,heathen,or infidel but "devout" This devout monotheism was the religion of all peoples in early human history Most cultures fell away from this religion but somedidnt

  • In 1949 when Mao&the communist came to power, there were only 1 million Christians in China. Mao was gung-ho on wiping out all religion in China. After 63 years of an iron-fisted policy towards religion, there are now 130 million Christians in China. They are converting at a rate of 30000 a day. We need some "atheist missionaries" to go&re-convert these Chinese Christians back to atheism. Do we have any volunteers? BTW Mao did wipe out much illiteracy but as literacy increased so didChristianity

  • John Wycliffe1330-1385 who translated the Bible in 1382 from Latin to the early-middle English of the day beleived that the Bible should be in the language of the common folk&in their hands as well. He died in 1385 but in 1442 his remains were dug up. A trial was held&his bones were burned until they were powder&then dumped in a river I read his lifestory.

  • @RonSafreed

    Your copypasta with poor grammar is totally off topic. Why did you just waste 1500 characters?

  • The Bible has been accessible to the common man for less than 500 years. William Tyndale1486-1524 was the first to mass publish Bibles for the common man starting in 1525 using the printing press.He smuggled them into England from Belguim&they cost a common man's week wage. He was a hunted man who was caught, tried&executed in Brussels Belguim. I read his lifestory.The Bible was under lock&key for over 1000 years.Even many clergy did'nt have access to it. It took 10 months to handwrite a Bible.

  • In 1970 I had a school teacher who in the summer of 1969 was part of a group that smuggled a suitcase of Russian Bibles into Moscow. His story of how they prayed that the suitcase would not be checked by the Russian customs people at the airport was amazing, it was not checked&the Bibles got into the hands of Russian Christians that needed them. Remember the Bible was a banned book at that time. FYI. Banned for 75 years back again 20 yearsThe Russian, Soviet peoples were educated&literate FYI.

  • In the former USSR1917-92 atheism/evolution was taught daycare-university The Bible was banned&it was illegal to teach it to kids Within months of the fall of the USSRin 92 the Bible was put back in Russian schools Olga Lutsenko an atheist was the main one behind it Death threats made her go to Canada in 96&she is a Christian now BTWshe is on youtube&I support her work financially distributing Bibles in Russian&Ukranian schools Amazing how fast the Bible came back in Russia after 75 years absent

  • omg at the end you can see the old yt layout it looks so different

  • Lol this vid wasn't biased at all, was it?

  • @Everett27x

    What bias could possibly be involved in actual research? And how could "bias" somehow influence the results of this investigation?

    I don't think that word means what you think it means.

  • @Everett27x what do you meen?

  • Thanks so much - my bio class will watch this - KEEP the vids coming!!!!!!

  • I watched a video, I commented on the video. If you dont like my comment then I am a "troll." If I reply to anything you say then I am "troll" Got it!

    Run along number two, someone is insulting your boss.

  • @TheZooCrew and the guy whose ass they kiss...Oh, he has a graduate degree in Biology and this is what he is doing with it. This is his "area of expertise." Who are you!? Oh yes, his defender, the gatekeeper. Lol! What is this business about a "soc" account? What is that exactly? Anyone who has opened an account in the past year is guilty of what? Jeez, go...use your Biology degree to make list of people and bother them with e-mails so you can disprove a list while stroking your ego. Don't forg

  • @Frab2001

    Is this how you get off? Or are you just a troll?

  • i hope those who have there name on the list who do not want it will sue over it

  • You aren't " Doing it for the children in our public school systems." You are doing it so your viewers will give you a pat on the back.

    Hey, honesty stings a little.

  • @Frab2001

    Seriously? All the stupid, pointless videos on YouTube and you criticize THIS one?

    Oh...you're probably a sock account. Joined on December 7, 2011. Answers a few questions.

  • @TheZooCrew

    I apologize if if I misunderstood the intent of this video. However, you never mention any other reason for researching the list, other than proving how few "real" scientist are on it and how few of those scientist actually believe in common decent. You said this took you 5 minutes. To get the information, attempt to contact everyone on the list, get a response from and respond back to 16 or more scientist. Make the video etc... Just something you whipped up in 5 min huh? This serv

  • Why do you care? Think about it. You said yourself that what...0027% of scientist in the US reject evolution right? So, if it's that small of a percentage and the majority of scientist do accept evolution as fact then, why do you care? The numbers are actually that small and yet, you researched the list of 100 scientist. GET A LIFE!! Do you realize that your behavior is more fanatical than some of those freaky fundalmentalist Christians??

  • @Frab2001

    "Do you realize that your behavior is more fanatical than some of those freaky fundalmentalist Christians??"

    That's not even close to true. He's not protesting funerals or killing abortion doctors. The research behind this video probably took about five minutes.

    Why does DonExodus care? Do you live in the US? Creationists are constantly appealing to authority to enforce their assbackwards religion into the government and schools...and the politicians pander to them!

  • evolution is impossible . it has been proven that you can't get life none life.

    evolution starts with nothing then nothing explodes.

  • @animefan2k9 what does Abiogenesis have to do with evolution? And do you have a reference for this claim.

  • @AWEF321

    Your atheism is illogical. You cannot know there is no God. To do that, you'd have to know All things to know there is no God.

  • Question : "Hmm so how do you explain Endogenous Retroviruses?"

    Answer: "GOOOOOOOOOOOOOOOOOOOOOOODDD!!­!"

    That's what I think it would be... xD

  • It's fairly simple to understand, The Universe had a beginning and it didn't come into existence with outside help.

  • donexodus is just liar and a chicken since he love his religion of evolution which is not science. evolution will never be proven. evolution is fake science

  • @animefan2k9 There's a reaason why scientists and people like Donexodus don't need fake, soc, or bot accounts like yours. Because honest people have no reason to use such deciet. Why don't you do the right thing and state what your real account is?

  • @animefan2k9 That's right keep your head in the sand. People like you should be denied the fruits of science (food, clean water, medical aid, technology....)and only given the fruits of religion (errrrr...wich fruits?)

    Or are you troll (insert Poe's law here) in which case you're extremely funny!

  • @Floortjahh another fool that has her head in the sand

  • @animefan2k9 nice comeback creotard!

  • @animefan2k9 >calls him a liar

    >fails to justify it

    lololololololol

  • @technicallyabsurd  he lied about the rule s that nephlimfree setup for his blogtalkradio debate.

    and evolution is full of lies you just don't want to see it.

  • @animefan2k9 what lies are we talking about

  • /watch?v=8RKPveLyJYo

    /watch?v=U0TMFX4IoiU

    /watch?v=OpdqDpxleoM

  • @animefan2k9 have are these lies from evolution exactly?

  • @AWEF321

    Are you a strong atheist or a weak one?

  • Even when the title sounds anti-evolution or the like, I always know a video isn't Xtian the instant I see that the Like button is enabled.

  • This is unequivocally badass.

  • Brilliant. Thanks for taking the time to do that grueling leg-work.

  • Again. Very nicely put . . .

  • Where is the proof of evolution anyway?

  • @Danvideos123 transitional fossils, chromosomal evolution, and the basic mechanics of breeding to name a few.

  • @Danvideos123

    Search "evolution" on PubMed. You'll get over 300,000 publications as a result.

  • Everyone knows that god was a dull ordinary boy until the day that he touched that magic crashed meteorite. From that day forward he was known as our super-lord. He spent his days whipping up dna strands with his bare hands and performing speedy immaculate conceptions with unsuspecting virgins. Our Super-lord Faster than a light beam and able to leap tall supernovae with a single bound. Is it a bird. Is it a plane. No, it's a bearded dude. Next episode: Rise of the horned crusader. Dr Satan

  • darwin was funded by the roman catholic. you may be part ape , so keep that concept. I am number 3 on the list. scientists are hired , and many are mysterious killed also. why not do research on that topic. why are you trying to convince us? I know why your catholic.

  • @MumblingMickey Ignoring some people is the best option. when that person really is a moron who doesn't have the capacity to be open-minded enough to acknowledge that what they know changes too much to be considered a fact or proof. As of 5 years ago we thought that we only had 9 planets in this solar system. yet now we know there isn't. You are one of these people.

  • @anonymousnamealso Yeah I'm sure I'm all of that...a close minded, unscientific erm... physicist! I've been a close minded physicist for 24 years now... and oddly thousands of students never noticed my closed minded approach to science your keen senses seem to have picked up on...

    odd the way all the most skilled intelligent and educated people seem to be the ones you disagree with most....hmmm?

    BTW Pluto didn't disappear....it was just reclassified... its still a planet... a dwarf planet!

  • @MumblingMickey Funny cause pluto became an asteroid for a year. That changed, then science said there's a bigger planet that's dark behind it. which would  make either a 10th. or not a planet. Now it's a dwarf planet. which means that now there's a tenth planet. and yet Christianity or religion in total is for stupid people! Science always changes cause it's always wrong. I know broke and stupid as hell Physicist. Doesn't make you smartest just book smart. there's a difference.

  • @anonymousnamealso

    "Science always changes cause it's always wrong."

    Tell me, why does your computer work if science is always wrong?

    I don't expect you to answer this properly, seeing as you're a functioning illiterate.

  • @TheZooCrew I have to constantly get my computer fixed. the fact that you can finally get something to work right doesn't make your statement anymore true. all things will eventually work right if you tinker with it enough. Science is always wrong then they get a theory. Computers is engineering. not science. SHUT THE FUCK UP about shit you don't get. I fix computers often and it's always been a problem.

  • @anonymousnamealso

    "all things will eventually work right if you tinker with it enough."

    Wow.

    "Computers is engineering. not science. "

    *facepalm* How are you still alive with an IQ less than 10?

  • @TheZooCrew computer engineer. ever heard of, it. now they design and make sure it works right. computer science thinks up ways of calculating equations for processing. computer science is why we constantly have issues. computer engineers is why we tinker til it's fixed. whole IT field Moron does this

  • @anonymousnamealso

    Let's just invent whatever definitions for words we want and totally ignore their consensus definitions in dictionaries.

  • @anonymousnamealso So what you are essentially saying here is that Alan Turing was wrong, Jack Kilby was wrong...and that is evidence because you haven't the foggiest notion how to look after your own computer?

    Y'know the problem there is that if you read a book on computer hardware and software maintenance....all of a sudden computers the world over would seem to work better [facepalms]

    I think you'll find computers work...as opposed to trying to run a spreadsheet on say a plank of wood!

  • @TheZooCrew You can keep your job as physicist at McDonalds and I'll keep mine. Bottom line is you can't handle what both fields really do. More importantly back to the Subject. Science is always wrong. There's no truth to an idea until it becomes a undeniable fact. Other than that you're a fucking moron wishing he was smarter with theories that will  never pan out. While my way has scientific physical evidence all around it.

  • @TheZooCrew Oh and notice how many dimwits it takes to gang up on 1 who believes in God. Yet you still can't answer basic questions in regards to science. This convo should be through but you'll claim that you're intellectually superior when you're not. Guess what a degree is good for? Cleaning up messes. The richest men in the world don't have one and they seem to be way smarter than you. Eh. Stop placing so much faith on a piece of paper and start learning something that's real.

  • @TheZooCrew imagine how much it would cost every year if you had a house full of computers and a network along with not the slightest idea how they worked or what was wrong when something went arseways...

    It must cost a fortune to have a built in aversion to learning how things work...every time something stops working you have to BUY the services of someone that knows about the things you don't like knowing about....and refuse to learn... thats lunacy.

    He's not too bright thats for sure.

  • @anonymousnamealso "Computers is engineering. not science."

    so 'Computer Science' is what? look the point is almost everything around you right now... is the product of science...since things are discovered BEFORE someone uses that discovery to create a solid object or put the discovery to use...

    So before engineers could design and build computers. They had to be demonstrated to work by experimentation, testing and a shit load of work, they did not just spring from the air... nothing did!

  • @TheZooCrew Oh and since you feel science is never wrong. Why haven't I ever heard of a Gorrilla,ape, monkey, chimp that speaks any human language or can at least drive a car, how about not crap on themselves. Cause science is wrong. Just cause you change up a BS theory doesn't make it any better it's foundation is still BS.

  • @anonymousnamealso

    Because babbling incoherently is a valid form of argument.

  • @TheZooCrew Then you argue very well for a chimp

  • @anonymousnamealso

    "Funny cause pluto became an asteroid for a year"

    Not sure where you heard that... there was no proposal to make planetoids made of ide asteroids? where did you getthat from?

    This entier thing stems fro the fact that the word 'planet' had never been classified... thats all it refers to.... it has nothing to do with religion...

    Yes obviously I'm just stupid...

    So you wouldn't want to be conversing with a moron... So I'll call the conversation to a halt.

  • @anonymousnamealso You are actually in full argument over a matter of semantics... they could call pluto 'fred' if they liked and say its a 'rocky ice ball thing' and it would change the classification... but not anything 'known' about the thing.

    Yes being a physicist will in fact *probably* mean I'm brighter, ie able to reason faster, better and with more accuracy.

    Not sure why you would bring that up since in this case it does you no favors and many scientists are religious.

  • No, many members of Discovery have never rejected evolution or common descent, such as Michael Behe, whose book I'm reading. Michael Behe, who is a Phd in biochemestry sees no way that random forces could produce and create the wonders of dna and the complexity in living things. DNA is so complex that Bill Gates said: Human DNA is like a computer program but far, far more advanced than any software ever created. So there is great logic in being skeptical of the two Darwinian mechanisms.

  • @KrisMayeaux

    Also, why do you continuously refer to evolution as "Darwinism?" It isn't any more and never really was. You know who calls it that? People who don't know what it is. Darwin isn't anything more than a historical figure today; a footnote in the history of evolution. The modern synthesis is far beyond anything he imagined. There are actually THREE mechanisms of evolution, as well.

    Name a single testable, falsifiable tenet of intelligent design.

  • @KrisMayeaux

    Finally, it's a straw man to refer to evolution as "random forces." Natural selection BY DEFINITION is a non-random process. Michael Behe knows this, but as he proved at the Dover trial, he has no qualm with lying his ass off for the Discovery Institute.

  • @KrisMayeaux Yes indeed Behe, the man who proposes an idea but then can't quite work out how this idea could be tested.

    Then goes on to plagiarizer other peoples work and release it as if it were new discoveries... whilst also not quiet smart enough to realise everything he plagerised was in the public domain...that Michael Behe?

    Tell me? any place in his book he shows how he might demonstrate this idea?

    BTW natural selection is well demonstrated artificially, we call it artificial selection.

  • The original list is over 800 now (not 100) & here is another list of scientists & scholars who are skeptical of Darwinism. Do you mean to say that a Ph.D in Physics or another subject isn't educated enough to to understand Darwinism, however YOU didn't even understand the statement. Jerry Bergman PhD has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology, is now completing his 9th degree & has assembled a list of 3000 skeptical of Darwinism. Google it

  • @KrisMayeaux yeah cause lying about 800 people is so much more academic than lying about 100 people, thats like me creating a list of priests that dont beleive in god, lying about what they said, what i asked them and then publishing the list, never removing anyone that asked to be removed and adding people constantly just because, yeah its so offically awesome

  • @deathman1021 Darwinism teaches Natural Selection, which only selects from what is there already & Random Mutation created all the complexity of life. A brain can't be mutated! So many scientists are skeptical because these 2 mechanisms don't have that ability in the lab or in real life. Common Descent can be either evolution with an Intelligent Designer guiding it, or Naturalistic evolution. The document NEVER EVEN ADDRESSED COMMON DESCENT! So this video is foolishness!

  • @KrisMayeaux wow that is so wrong i dont think even two thousand characters would be enough to refute it.

    learn the subject pal it will really help you understand what you are talking about

  • @KrisMayeaux " A brain can't be mutated"

    yes it can... if you change the instructions on how its put together... which is why an alsation... will be a lot smarter than a labrador... because it was artificially selected for intelligence.

    The people on that list have no clue about evolution, natural selection, genetics or anything... they just don't know! So their opinion of something they don't know anything about...can be pretty safely ignored.

    Plus ID has been demonstrated to be nonsense.

  • @deathman1021 It's like a Discovery Inst. scientist asked other scientists if they liked cats & they said YES. Then another person went around asking the scientists why they said they don't like dogs. Discovery NEVER asked about common descent - but about mechanisms. Many scientists believe in Intelligent Design guided evolution along with common descent, instead of atheistic evolution like Darwin. And some are Young Earth Creationists and most are not, and no one said they all were.

  • @KrisMayeaux no they dont, the vast majority of scientists dont belive in inteligent design at all, not even guided evolution

    the only ones that do believe in creationism are the ones with mail order degrees

  • @deathman1021 Whether they believe in ID, Creationism, or Atheistic Evolution is not the point. The point is that the statement says NOTHING about Common Descent or even Evolution per se - it is addressing the 2 main Darwinian mechanisms, and whoever made this video is either dishonest or is clueless. Besides that, there is a list of over 3000 now who are skeptical of Darwinism. Have you checked that list assembled by Jerry Bergman PHD with9 degrees(not mail order) Google: 3000 Darwin Skeptics

  • @KrisMayeaux I googled it and it says, (exactly) "The following worldwide scientists and educators (by the time this list was published some may be deceased) all reject ―Darwinism according to the following definition: The belief that evolution and common decent can account for the existence of all life." It also says, "Most persons on this list are also skeptical of the ability of random mutation and natural selection to account for the complexity of life."

  • Comment removed

  • @KrisMayeaux The statement DOES say that they reject common descent. It's right from the "3000 Darwin Skeptics."

  • @TheRunner314 But we are not talking about the list of 3000 made by Jerry Bergman PhD. which has nothing whatsoever to do with the Discovery Inst. list that this video is talking about. This video makes ridiculous accusations that are completely untrue about Discovery. I only mentioned the other list to show that many other scientists are skeptical besides the Discovery signers.

  • @KrisMayeaux Discovery Institute rejects evolution, and many of the scientists on this list are not even biologists. The person who made the video mentioned the "2 Darwinian mechanisms." He's not being dishonest. He's pointing out how Discovery Institute is making it seem like every scientist on this list rejects evolution. Any scientist who found evidence disproving the central tenet of biology would probably win a Nobel Prize. There's no scientific conspiracy.

  • @KrisMayeaux

    You could have a list of 10,000 scientists and it would still be a spit in the lake. Besides, none of those lists are honestly compiled...Bergman is a damn liar and I can prove it.

    Also, who the fuck cares if a physicist or a mathematician rejects evolution? It's not like they know shit about biology relative to a biologist.

  • @KrisMayeaux Y'know I'd bet my house on the fact that if we 'only' took real scientists whose name was a derivative of 'steve' or 'stephen'... and some of them bothered to sign a piece of paper saying creationism was nonsense it would be a lot bigger than that.

    Ohh wait there is a list like that... lol... Do you really think science is some sort of numbers game...

    If every scientist in the world came out to say gravity wasn't true... well you know what... things would still fall!

  • Excuse me but this list never even addressed Common Descent !! Are you kidding me? It is saying they are skeptical of the mechanism of Natural Selection and Mutation to have the capability to have brought about the complexity and diversity of life as we know it! You are so dishonest you should be ashamed! It never denied evolution either - just the ability of Darwinism to account for the mutation of a brain, eye etc. The two mechanisms are not creative enough to cause macro-evolution.

  • @KrisMayeaux

    "The two mechanisms are not creative enough to cause macro-evolution. "

    This is nothing more than an argument from personal incredulity.

    Jerry Bergman needs professional help. Arguments from authority are useless.

    Did you even watch the video? The list is dishonest in every way, from its premise to what its proponents say it means to what scientists actually want to be on it.

  • Brilliant exposé, thank you! That people would use such deception to score points for their ‘side' only goes to show what kind of people they are.

    Funnily enough, there are more historians who deny the holocaust than scientists who legitimately deny evolution as truth.

  • If anyone has a legit reason and proof as to why evolution is true, please reply and be sure to include what form of mental problems you were diagnosis with as a child, as that is important in this case.

  • I believe in Creation. Darwin-free zone here!

    

  • Only seen a couple videos and I want to say thanks for going through all the trouble that you do in search of knowledge. totally pwned this stupid list.

  • Nice research.

  • Magic is science for the ignorant.

    if you think that evolution or the appearance of life in this planet is a work of god(magic) you are just ignorant. people who understand and know how it works know it's science.

    the thing that makes it magic is the fact that you don't know, by the fact that you don't know you call it magic, by the fact you think it's magic you're ignorant.

  • @Nixom1334 The idea of God creating everything is much much more likely than everything coming together from a random puddle with some chemicals in it. That's like saying a dictionary resulted from an explosion in a book store from a bunch of random letters coming together into perfect English. You apparently don't understand the complexities of "simple" single celled organisms. E. Coli contains more information than every volume of the Encyclopedia Britannica combined.

  • @wasdare32 things only seem designed because we're in the situation. let's say you win the lottery when you were short on money, you might say it's destiny but in contrast let's say you didn't. the norm is you not having money so if you don't win it it passes and you move on because it's normal. if you win then it's a big deal. no one designs who the winners are, it's random. we won the lottery of life so we see it as destiny, not realizing that if we hadn't we wouldn't even be able to ask why

  • @Nixom1334 You matching a random series of 6 numbers has nothing to do with life. If just a few letters were off in our DNA, we wouldn't exist. Same with all species. The chance of everything in the universe lining up like it is to support life has been calculated to being close to 6 thousand trillion to 1. No one seems to understand just how much it takes to get life started. If it were easy, then new life would be popping up in lakes all over the world.

  • @wasdare32 take this example. I'm doing a secret give-away at the super-market. the 100th shopper will receive $100. no one will know about it except for the person that wins. if you're the 10th shopper your life is unchanged because you had no idea there's a give-away. but if you're the 100th it seems destined. the 99th and 101st shopper were so close but you won. but it's all random I didn't set it up so you'd win. you didn't wait to be the 100th shopper it just happened (cont.)

  • @Nixom1334 That example makes no sense comparing it to evolution. To give away money takes intelligence and will, something that didn't exist before life. I think you're trying to talk about mutations or something to do with natural selection, which in that case comparing it to giving something good away is wrong, because even if DNA mutates, 99% of the time it results in something bad or deadly. And dead animals can't pass on traits to evolve.

  • @wasdare32 exactly. dead animals CAN'T pass DNA. so if it doesn't work it's not passed. we only see the wining customer. if i have 3 dice with random letters on each side and rolled them to get words I'm not always going to get words, but if I RANDOMLY get a word I'll write it down so when I'm done you get a list of actual words there is no need to write down words that aren't real.just because I can randomly get a word doesn't mean I manipulated the dice

  • @Nixom1334 So you take these dice, roll them, write down EVERY LETTER YOU GET, and somehow you now have all 30 billion letters in the perfect order JUST TO GET THE ORGANISM TO GROW A FINGER. That's complete crap. How do you explain the eye? Just to get a "simple" eye that only detects light, you have to have countless chemical reactions, all happen at the perfect time, in the perfect order, and even a mutation of ONE LETTER renders it completely useless. Same with the ear, and every other organ.

  • @wasdare32 No! you only write down full words. if you have cac that's not a word but change one letter and you get cat, car, cam, can. you're still slithering around this, if it doesn't work it's discarded. you're looking at it backwards. you say we have fingers, what are the chances that DNA specifically formed to make a finger. it wasn't trying to make a finger. it's not that life was looking down a list of organs and trying to build them, it made organs and if they worked they stayed.

  • @Nixom1334 But if you take cat, you can't make gatcgatcggatcgatggatagattcccga­gctcg. That's just a fraction of the information needed to make a cell work. There are trillions of combinations of the four letters in DNA, and being off by ONE letter makes something unusable. Cells can't just say "this doesn't work, so I'm going to write down the next word I get". It takes what it has and uses it. But we aren't born today with extra DNA trying to make a new organ or arm. It's already there.

  • @wasdare32 first off, I'm not actually using the DNA base pairs i'm giving a simple example. and it's not that DNA is writing or ignoring is that if it writes down cac and it doesn't work it's going to die so it's information is lost anyways. mutations happen over a while, the cell isn't trying to turn into a human. it replicates, a mutation is faulty replication. if a mutation kills it it won't pass that mutation but if it helps it it has better chances to survive and that new code copies ...

  • @wasdare32 ... because it has better chances to survive it has better chance to reproduce and pass it's code. now we have 2 different codes trying to pass their information. when another mutation happens, once again the bad codes are discarded and the good stay this is how animals begin to branch off. eventually the codes become so different they become different species. each code is similar to the code before it but not necessarily the other separate codes. that's why people don't have wings

  • @Nixom1334 If that's the case then we should find fossils of animals with halfway developed arms and animals growing wings since everything happens in steps. But all fossils are completed animals. No half fingers, no extra organs or arms, no animals trying to form eyes. It's a fully formed animal one minute, it stays the same for millions of years, then it dies and another species comes out, and scientists try to connect them and find missing links that don't exist.

  • @wasdare32 well actually they have fossils of fish with fins that work like limbs, and if you look at the structure of most appendages they are the same. a whale has fingers, why would god give whale fingers it's faulty design because they don't need fingers. he should've just stuck the fin in there. but we know whales were once terrestrial, like ambulocetus. as for the missing link. there is no "the missing link" there are hundreds of transitional fossil though.

  • @Nixom1334 Correct me if I'm wrong, but evolution is still going. So we should see animals today with growths all over their bodies trying to grow something useful. Animals should have halfway developed wings and eyes. But every animal is perfectly completed, nothing unneeded or still developing. The whale has fingers because it basically has advanced webbed feet. It needs something spread out to attach the skin and muscle too, otherwise it would have something the size of a finger to swim with.

  • @wasdare32 there are no animals with half arms because the code for an arm has already been found. DNA is only trying to replicate if it fucks up and makes something useful it keeps it. it's not just randomly making eyes and arms

  • @wasdare32 another thing. nothing unneeded? have you ever heard of vestigial structures? the human appendix, snakes do actually have tiny feet, the wings on an ostrich, even birds have the genetic material to make teeth, although it's a dormant code

  • @Nixom1334 In Darwin's time, there were over 200 structures in the human body considered vestigial. All but two now have their use discovered, including the appendix which is a safe haven for good bacteria when we have intestinal problems. It seems that everything we have has a purpose. Snakes use their "leftover legs" to help push them forward to crawl faster. What purpose would a snake have to lose its legs? It limits it's ability to move and find food, opposite of what evolution states.

  • @wasdare32 I have never heard of a snake being able to even use it's spurs.and if you think that snakes are unable to move without legs you've obviously never seen one move. side-winders, tree-boas, anacondas. no legs but they move fine.

  • @Nixom1334 They give it more traction instead of it just pushing against itself to try to move. Which is the worst way possible to get around.

  • @Nixom1334 They give it more traction instead of it just pushing against itself to try to move. Which is the worst way possible to get around.

  • @wasdare32 last I heard they used their abdominal muscles.

  • @Nixom1334 Well please throw yourself on the ground and try to crawl using only your abdominal muscles and tell me how it works. If mammals and snakes both evolved from reptiles, you should have no problem doing it since we are more advanced in terms of evolution. Your car has grooves on the tires to improve traction on different surfaces, just like a snakes skin and the "vestigial" arms help it gain traction.

  • @wasdare32 wow you're a moron aren't you? birds also evolved form reptiles why don't you throw yourself of a building and flap your arms. see how well you fly. we didn't evolve from snakes or even under similar circumstances. we have legs so we aren't built to move like a snake. a blind person's other senses are much more highly tuned then ours because they can't see. different circumstances matter it's not just we're more evolved we can do everything the lower animals can

  • @Nixom1334 Well then what happened to birds? They just grew wings that didn't work for millions of years, and then one decided to jump out of a tree for no reason and start waving it's arms and discovered it could fly, and he ran around and told his friends that they could all fly, so all the birds were suicide jumping out of trees and flapping like maniacs hoping not to die. And now, somehow they all instinctively know that they were born to do this? Yea, that sounds reasonable.

  • @wasdare32 well as you might know, wings are actually modified arms. also wings were usually developed by small, usually bug chasing dinos. now, alot of these dinos were arboreal to get to their food source and fossil finds suggest that they were already growing fathers. at small altitudes the better developed feathers made no difference but as they ventured higher the ones that were at least able to glide saved their asses from falling. they didn't jump in purpose but when they fell they lived

  • @Nixom1334 But this happened in many different locations simultaneously and exactly the same? At the time the lizard supposedly started evolving into the bird, Pangaea had already split and was too far apart for the animals to have any contact with each other. So they continued evolving from *random* mutations to be exactly the same today on each continent, even though they spent millions and millions of years apart. All birds have the same basic stuff. Feathers, eggs, beaks, wings.

  • @wasdare32 exactly the same? so a bald eagle looks, like a penguin, which looks like an ostrich, which looks like a Kiwi, which looks like a peacock? there are two possibilities, one this animals were evolving wings and to accommodate flight you need the same basic things, strong breasts, light bones. or the basic bird had evolved and migrate it to everywhere else. some birds even flew to places and then evolved to be flightless, like the kiwi and the Kea

  • @Nixom1334 Yes, apparently you need these things for flight. But your telling me that all birds have these traits from random mutations? Bats and insects have wings from random mutations? If it was all random, then everything would look different and act different and there would be nothing linking us all together. People who live in Africa would be different than people who live in Mexico or Europe, giving racism a reason to exist. Random mutation doesn't give every living thing the same brain.

  • @wasdare32 as for the race thing,put a mexican, and asian, a white person, and an african together, assuming noe of them are mixed it's not that hard to tell them apart, and that's with us all being the same species. and you're on crack if you think the wings of a bird, a bat, and a bug look the same. some wings within the bug family don't even look the same

  • @wasdare32

    "If it was all random, then everything would look different and act different"

    You have forgotten totally about natural selection. Your stupidity and ignorance aren't valid arguments.

    "They just grew wings that didn't work for millions of years, and then one decided to jump out of a tree for no reason"

    This is a straw man argument against Lamarckian evolution. Proto-wings can break high falls, anyway.

  • @wasdare32

    "At the time the lizard supposedly started evolving into the bird, Pangaea had already split and was too far apart for the animals to have any contact with each other."

    You know this for a fact?

    "So they continued evolving from *random* mutations to be exactly the same today on each continent,"

    They aren't exactly the same...and birds can fly.

  • @wasdare32

    "If mammals and snakes both evolved from reptiles, you should have no problem doing it since we are more advanced in terms of evolution."

    There's no such thing as "more advanced."

    Do you know what a reptile actually is, since Reptilia is now an invalid taxa?

    "just like a snakes skin and the "vestigial" arms help it gain traction."

    Natural selection at work. You can't just ignore a crucial mechanism of evolution and declare the whole thing to be wrong.

  • @wasdare32

    "there were over 200 structures in the human body considered vestigial. All but two now have their use discovered"

    "Vestigial" doesn't mean useless. It means it no longer retains its ORIGINAL function.

    "since we are more advanced in terms of evolution."

    There's no such thing as "more advanced" in evolution.

    Your argument is "I don't know anything about evolution, therefore it's wrong."

  • @TheZooCrew I know more about evolution than you and 98% of the rest of the world who believes it. Vestigial means that it lost all or most of its original function, which in simple terms so you can understand means IT DOESN'T WORK ANYMORE. The further down the line you go, the more advanced you get. You're saying we aren't more advanced than a trilobite or any reptile alive today? Well actually trilobites did have eyes more advanced than any living creature today, which evolution can't explain.

  • @wasdare32

    " I know more about evolution than you and 98% of the rest of the world who believes it."

    Clearly you don't.

    " IT DOESN'T WORK ANYMORE."

    Or it has a DIFFERENT function than it's original. Did you just conveniently forget this option?

    "The further down the line you go, the more advanced you get."

    By the "line" you mean "time." Yes, but this means we're no more or less "advanced" than any species alive today.

    "Well actually trilobites did have eyes more advanced"

    Citation?

  • @wasdare32

    If you're going to make the batshit assertion that you know more about evolution than every evolutionary biologist, why don't you publish peer-reviewed papers that refute the 290,000+ publications that currently support evolution?

  • @TheZooCrew Well then where's your paper about it? Oh. you don't have one do you? Then you have no more right to tell me what you know than I do to tell you what I know. The scientific community won't accept any other opinions besides theirs, no matter the evidence or argument. People used to be put to death for saying that the Earth was round because it went against scientific thinking at the time, even though you could easily prove it. Same thing today with evolution. No one cares to think.

  • @wasdare32

    "People used to be put to death for saying that the Earth was round because it went against scientific thinking at the time"

    Wrong. They were put to death because the CHURCH controlled everything. This had nothing to do with science. Nice try, Orwell.

    "The scientific community won't accept any other opinions besides theirs, no matter the evidence or argument."

    Wrong, If this were the case, general relativity would never have usurped gravity.

  • @wasdare32

    "Well then where's your paper about it? Oh. you don't have one do you?"

    Why do I need one? There are already 290,000+ by other more qualified people and they've all been peer-reviewed and verified dozens of times.

    "Same thing today with evolution. No one cares to think."

    Nice projection. Just because you've decided to swallow batshit conspiracy theories and wallow in ignorance doesn't mean the rest of us have condemned ourselves to your tragic fate.

  • @TheZooCrew Since when are conspiracy theories involved? Evolution doesn't make sense at all, and it goes against common knowledge and most of science. For you to bend over and take what the evolutionists say just makes you ignorant. Let me guess. You voted for Obama too?

  • @wasdare32

    "Since when are conspiracy theories involved?"

    Since you accused scientists of rejecting legitimate evidence.

    "Evolution doesn't make sense at all, and it goes against common knowledge and most of science."

    You have yet to prove this even a little. This is an argument from personal incredulity.

    "For you to bend over and take what the evolutionists say just makes you ignorant."

    I didn't do this. I accept evolution because it would be dishonest to not after examining the phylogenies.

  • @TheZooCrew Are you just going to quote me the whole time or actually have an intelligent conversation?

  • @wasdare32

    You haven't even attempted to have a legitimate conversation. You haven't answered any of my questions, you've made baseless assertions without any corroborating evidence, and you've totally dropped the original topic and have resorted to ad hominem arguments. What's intelligent about any of this? I'm done here.

  • @TheZooCrew You had nothing to do with this conversation before you jumped in.

  • @wasdare32

    Your argument boils down to "I'm stupid and I think you're liberal, so I'm right."

  • ...(cont) what you call design or purpose is just the random gathering of random events. where the elements for life randomly met with the conditions for life. if life had developed in mars you'd be a martian wondering why earth is life-less. we can ask ourselves why we're the dominant animal, because we are the dominant animal. do you think ants look at us and say "well humans are better then us because they are made in god's image"....(cont)

  • @Nixom1334 No. That "random gathering of random events" doesn't explain anything. We obviously have the right conditions for life, and we still have all the elements for life since we're all living. Why did life stop springing forth then? Animals should still be starting out as simple trilobites and evolving if that's the case. Just because there are some amino acids in water doesn't mean they'll come together in the perfect order to make a cell. They aren't living and can't decide to do that.

  • @wasdare32 the conditions now are not the same as the conditions of life when the earth began.

  • @Nixom1334 You're right. The early Earth conditions were extremely hostile. If the Earth was to go back to the way it was back then, every living thing would dead within seconds. But even with this hostility, some amino acids and his friends decided to combine, form a dozen different organs in a single cell, perfect write the DNA to make it self-sustaining and let it pass on it's traits, make RNA to correct damaged DNA, and give it the ability to be hit by radiation and change into a fish?

  • @wasdare32 well first you need an advanced chemistry class. as you MIGHT know because of the polarities and molecule structure, some elements can only combine with other elements and because of this the elements found each other randomly and paired. had life not been sustainable it would have died if it died it didn't passed on generations only the survivors did. again, we only see the wining ticket, have you ever seen the lottery announce all the loosing tickets? that's natural selection

  • @Nixom1334 I'm in college getting a Ph.D in chemical engineering right now, so yes I know a little about chemistry. Chemicals can find and link with each other all day, but that doesn't equal life. That equals a big puddle filled with bonded chemicals. Cells need information to survive, and information needs cells to be passed on. One can't be without the other. That's like saying if you put all the pieces to your car in a pool of gas, that everything will combine and use the gas as fuel.

  • @wasdare32 well chemistry is not my field of expertise but gas is not DNA. DNA is a chemical and Information. there's also combinations of phospholipids to make the cell membrane, then add the middle which is DNA which is a chemical, all the membrane has to do is form around DNA and you get a simple Prokaryotic cell.

  • ...(cont) like the tenth shopper, if everything stays the same it doesn't matter. only when something becomes special do we give a crap. only BECAUSE we were randomly the 100th shopper we can say "wow, I must be special because I had a 1% chance of winning and I won" had you not been the 100th shopper you couldn't even ask the question of why weren't you. the rocks on mars don't sit around saying "how come we're lifeless" had there been no life we couldn't ask.

  • Hahahah that Pattle Pun guy is hilarious. What in the world was he trying to sell? Lol

  • What a sleazy move on the part of the Discovery Institute, total scum.

  • The Discovery Institute, an institute that discovers and researches nothing. It has talk radio hosts & right wing talking heads on its board.

  • WOW classic propaganda tool...

  • Spectacular video! Thanks for clearing up the Lee Strobel lies, consider me a subscriber!

  • Wow! you are still running this nonsense? You have even less scruples than I thought! The list is so extensive now that you just show your ignorance, which I have exposed from the start. C ya Donexoducks.

  • @mejc2

    Project Steve

    (That's all I need to say really...)

  • @doGoNsIylbaborPerehT

    LoL. This list has grown by 1000% since this video was made. Have the number of evolutionists with the name steve increased by 1000%? NO. Gee I wonder why. It is because the two are unrelated and this list i