Added: 5 years ago
From: RobHCTRC
Views: 128,908
Sort by time | Sort by thread (beta)

Link to this comment:

Share to:

All Comments (263)

Sign In or Sign Up now to post a comment!
  • Fear Factory was a heavy influence on Slipknot. You can tell. Shawn even said that he was stoked to be on Ozzfest 99 with them headlining the second stage.

    Anyway, everybody rips everyone off. It's how music gets made. Bands take inspiration from eachother. That being said, I love both bands. No argument necessary.

  • One of the best introductions to an album and song in the whole musical world, this song gives so much energy.

  • COREY TAYLOR SUCKS BURTON I MEAN NOT BURTON'S BUT CAZARES DICK HAHAHAHAHAHHA,AND BY THE WAY SK SAID ONCE THEY MEANT TO BE BIGGER THAN METALLICA,HETFIELD NAILED THEM ALL AND LARS AND KIRK NAILED JORDINSON,HAHAHAHAHAHAHAHAHA PERIOD AS SK SAID ''BEFORE I FORGET'' THE LIKE NOT BE LEFT BEHIND BUT TO GET FROM BEHIND'' THEY ARE ALL FAGGOTS WITH DISGUISES HAHAHAHHAHA

  • is one of the shows where Burton loses his voice?  X-D

  • Burton sounds gassed but thats ok the end of the song still kicks ass.

  • Dino was fuckin gettin' down at 0:35 lol Dino is a Beast!!!!

  • fukin great!

    

  • fajny kilp

  • After the 90's most bands fell apart but Fear Factory are one of the few bands that still have great music.

  • @filth69ify1 hey man im a fear factory fan i like the song "resurrection" an i agree with u that only a FEW bands still hav great music u gotta remember that Iron Maiden is one of those few bands. i mean cause hav u like listened to "phantom of the opera" "hallowed be thy name" "powerslave" "run to the hills" "fear of the dark" "number of the best" and " alexander the great???

  • Slipknot fans: SHUT UP.

    Slipknot was good... up until 2007. Now fucking SEETHER beats them.

    And this is a Fear Factory video; why do you guys care?

  • ok people quit bitching slipknot and fear factory are good bands i personaly thing A7X is the best but thats my opinion so everyone stfu

  • 1. to be honest, stop comparing everything.

    2.just because you have to metal bands doesnt mean you gotta compare like little bitches

    3. i believe we can all find common ground with justin beiber and all those cock sucking fags from disney, so therefore, we should burn that mother fucker DOWN!

  • Slipknot was good when they first came out, now they're weaker than Poison.

  • Fear Factory is older, better and kicks more ass than shitsnot,,, shitsnot is gayy,, u cant compare with Fear Factory man,,,lol

  • first of all it looks like he has a little trouble with those high notes. SECONDLY this is FEAR FACTORY not Slipknot dammit so quit arguing you little bitches

  • this song is good but it like resurrection better. THUNBS THIS UP IF YOU LIKE THE SONG RESURRECTION!!!!!!!!!!!!!!!!!!­!!!!!!!

  • I will be the power surge...

  • petrifide, amplified .; i like that line

  • it is good

  • and now i;m complete, power source.

  • and shocked to "peice-s"

  • Comment removed

  • My Favorite FF song Awesome!

  • slipknot i love but is shit if compare with titas of metal like fear factory ,pantera ,machine head and old sepultura slipknot is good but noob

  • Im a slipknot fan but im not saying things like "SlipKnoT iS ThE bEsT". And remember - not all slipknot fans listen only to slipknot. 1 more thing - call the band like its called - slipknot.. i know you hate it but wtf guys ? cant you understand that this is lame..

  • @Sparky666Pivot shitknot shitknot shitknot shitknot go fuck urself bitch.

  • Comment removed

  • these guys are fucking legendary

  • Does anyone care about slipcock?

  • imagine if dino did a stage dive :O

  • Continued...

    I think Obsolete has to be their best album, but I love all the ones I have (Soul of a New Machine, Demanufacture, Remanufacture, Obsolete, Digimortal, and Transgression). Each of those is great in its own way. I've heard one or two songs from Archetype that I'm not crazy about, and I have no idea what Concrete sounds like.

  • One of my favorite Fear Factory songs. I bought Obsolete about 10 years ago, and I still find it amazing. Great video, awesome quality. Burton's clean vocals do not sound as good live (I learned that first hand at a concert a few years ago) but you can't blame him. They produce the shit out of his clean vocals on the albums. His "death metal growl" sounds great though, as do Ray (who inspired me to start drumming myself), Dino and Christian...

  • 0:33 was fucking terrible. this is way too fast.

  • dear god...fucking slipknot fans...."duuuh we're MAGGOTS! RAWR! Look how cool we are, we got are own dedicated slipknot fan name...MAGGOTS! but MAGGOTS is a hardcore name! RAWR!!!"

  • fear factory owns 

  • I like both FearFactory and Slipknot and I don't give shit about the shitty arguments. Grow up! Screw you guys, I'm going home.

  • I like both Slipknot and FF. Fuck you guys. If someone says that they like brownies better than cake, you can't fucking say "no, cake is better, it tastes better" thats retarded

  • this kind of music suck shit

  • you people need to stop arguing wasting time and hatred on whi likes what band more... that hatred needs to be directed at the assholes who hate metal

  • FF are the grass routes, SN are great, love them both, respect each other, listen to all metal bands and keep the music alive! FF are so hard a and raw where as SN have the music and the show but.....both are awesome

  • I love Fear Factory, but I am still very very bitter for their policy of confiscating any recording equipment during their shows. I took a few quick clips on my phone a few years ago and they had security take my phone and take $100 memory card out. Why are other bands ok with this but not Fear Factory? Fans would like to have a little memento of the trip to see Fear Factory and who cares about a dinky camera phone clip?

    When the vocals in this clip go high, the pitch is crappy at best.

  • gooog very goood !!! fear factory_sickness

  • lol slipknot sucks balls actually

  • btw is it me? or does burton has a slipknot tattoo in his arms? :$

  • @eddiekicksurass666 It's you.

  • @eddiekicksurass666 its not a slipknot tattoo,,,

  • @fpsliams yea it is, its slipknots symbol the bands are friends you know how many tours theve all done together... alot

  • what the fuck dude ive seen slipknot and im going to see FF there BOTH kicck-ass

  • fckn retardeds have some of you signed a contract with SK or FF ? let's face it theres no band with the perfect discography there are better songs than some others why just don't enjoy the music ? And are you that bad in real life ? LOL nerds

  • all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.

  • that brootal vocals at 1:15. "i have become a tyyyren"

  • get to see them april 2nd fucking fear factory for life mother fuckers!

  • @diabeticmonkey ur not stating a shit FUCK THE POSERS t(-.-)t

  • Slipknot is just radio friendly metal. I like Fear Factory and Slipknot both. I do think that Fear Factory is one of the most influential bands of the past 20 years. I also agree that music is art and should not be compared. Who is better vs who isn't is just stupid and a waste of time. If you like a band, good for you, I'm sure some people share your opinion. If you don't, then don't come around saying "they suck" or "so-and-so's better"....Be open minded and keep your mouth shut.

  • Bahahah 3:52.  Christian's like humping his bass.

  • @EvilHippy38  haha he realy loves that bass doesnt he

  • Can people not compare slipknot to these guys..thank you..ITS FUCKING ANNOYING JUST FUCK OFF AND SUCK COREY TAYLORS DICK IF U DONT LIKE THIS GET THE FUCK OFF THESE VIDEOS YOU NOOB PUSSIES!!

  • best song of FF for me, drummer is insane when i first listen the album in 1998 i couldn't believe the drums for real.

  • @melihsahcan - very good....but no Tomas Haake :)

  • I never saw FF at a festival like this because didn't want to hear what to me sounds like distorted vocals and some of their music. I only saw them at much smaller venues like HOB to get the full impact from like fifty feet away and the music and vocals vibrated right through me-so intense

  • its a question of taste which band someone likes better or lesser, i know slipknot and FF and many others and both of them do a great job in my opinion ;-) stop comparing bands , music = art and therefor not competitive in my opinion ... listen to what u like and dont listen to something you like not, its that simple !

  • I think someone whos favorite band is morbid angel knows what death metal is. Its a simple fact that slipknot is influenced by death metal. A few of the guys in slipknot were in anal blast. I know thats more pornogrind than death, but they still have a common sound. I'm not trying to say that slipknot is the best band ever, but i am stating a fact.

  • Fear Factory are a fuckin industrial "big deal" metal band. Please dont compare them with "evil music for 14 years old kids" band, which is Slipknot . FF been around since the early 90s and were one of the most important band (together with Pantera) of this era. They influenced the whole modern metal/core scene (which sucks btw.)

    Slipknot were and are a mainstream metal band that is embarrassing for the fans of REAL heavy music.

  • I definitely wouldn't consider slipknot nu metal anymore. Way more death in their sound.

  • hahahahahah you are funny man!

    Are you sure, you know what death metal is?! I think you dont.

    "Slipknot are death metal " - Ohhh boy, nice joke :)

  • Slipknot is Nu Metal, Fear Factory - Industrial Death. There's a difference, don't you think? Oh, and FF are pioneers and have been around way more than knot.

  • 0:44 Check the dude in the down right corner. Thats a metalhead stoner. =)

  • hahaha

    Tru

  • TRUE********************

  • funny to see comment about slipknot on every metal song ive seen so far :/

    like its the only band....

  • Slipknot fans: Get the fuck out. You're always saying that knot is better than all other metal bands. GTFO now. Fear Factory owns shitsnot.

  • seriously, slipknot's fucking gay now. i can respect their demo, but everything is gay as hell.

    obsolete=best album ever

  • hey kid, shut up

  • hey matt, shut up haha ;]

  • They do Own slipknot. I like slipknot alot. But Fear Factory is wayyyyyyy better.

  • im a slipknot fan but i know for a fact fear factory is better than them

  • @darknessawaits89 I like Slipknot, I don't think they can compare to alot of metal bands out there today? Hmmm, I think you should say 'Slipknot kid fans'.

  • @darknessawaits89 dude i tottaly agree with you slipknots alright but when i picked up a fear factory album i tossed the slipknot album out the window and now

    FF is my fav band

  • @darknessawaits89 Amen to that

  • @darknessawaits89 Slipknot isnt even metal hahahahah! so wheres the argument? Slipknot fans are anal as fuck and need to leave the Fear factory world alone because FF will ALWAYS be better than CLITKNOT!

  • @darknessawaits89 i love fear factory as much as i love slipknot, i find that a very unfair statement

  • @darknessawaits89 i total agree how can u compare something like slipknot which just random shit to Fear Factory which just rocks

  • @darknessawaits89 i like slipknot but i definitly like fear factory better

  • Every bloody music video on youtube I see arguments about whether Slipknot is better than whoever. Its music! Its opinion! Just listen or gtfo.

  • okay to u who r arguing over whos better notice wht tat he has on his forarm

  • is very good

  • FF are great but C Bell sucks at clean sing

  • totally out of key isnt he? its the same for most metal bands these days, its a shame really

  • I totally agree

  • Why argue over such trivial BS.2 completely different types of music.DUMB ASSES!

  • Listen fagot Gene Hoglan play with very more aggressive bands like Death, Dark Angel, Testament, Strapping young lad, so go to eat scum, then Raymond Hoglan is better, and more professional because I have more time in the road that raymond, he begins in 1984 what was doing herrera in that moment ?, in the school starting to learn the alphabet, fucking ignorant.

  • actually being a slipknot (see my name?) I gotta say fear factory is WAY better

  • fear factorys really beast ass when it comes to slipknot ehhh id say there both really good

  • Fuck slipknot Fear factory fucking owns them!

  • Cazares is back, with burton c. bell, but the bassist and raymond isn't in this new line up, i hope that will be better because the new drummer was in the band Death and Testament, this gonna be huge.

  • First of all, learn how to type, you have spelling errors all over both of your comments... second of all, raymond herrara is one of the main reasons why fear factory is so fucking good, he's one of the FOUNDING members, and although gene hoglan is good, he's not raymond herrara.

  • Shitknot?, the poser copy of MR. BUNGLE?, juas,juas,juas, fucking shitty music slipknot if for faggots that likes mainstream MTV music. Period. And of course Fear Factory are better.

  • damn strait mike! damn strait!

  • Fear Factory was the Fucking loudest concert I have ever been too. My fuckingn ears rang for a god damn week.

  • tell me about it i gat out from one of there concert all beat up from to much muchpiting

  • dino cazares rulez!!!!!!

  • Used to sing a lil´better

  • man raymond is a machine...

  • hey,man,fear factory is older than slipknot

  • hahaha and better than Slipknot

  • wat's with all the bitching about fucking slipknot...

    fear factory and slipknot r both kickass bands so leav it at that faggots!

  • great band

    (man theyre fat!!!)

  • i miss violator, i mean... Dino XD

  • I love Fear Factory and I have seen them play better than this, maybe they were tired or ill or something, it happens to all of us. Burton does look like Corey Taylor a small bit, it also looks like the Slipknot S he has tattooed on his forearm, maybe i'm looking at it wrong though.

  • I think it's just a tribal tattoo...could be wrong, but that's unlikely, lol

  • you mean to say...

    Slipshit must have stolen their logo from Burton's arms?

    i kinda thought that...but the reality is that they probably took Burton's arm and Seplutrua's logo and boom...Slip-in-shit!

    lol why are we even talking about this?

    lol slipknot sucks gay cock!

  • hahah lol thats great...for a second there i thought you were serious...i know...slip-n-nut is such shit!

    i'm glad you see things clearly! lol

    FF rules you bitch!!!!

    BTW

    I will not stand for condemnation

    Ive become the volts

    To lead the revolt

    Fuck with me ensues certain danger

  • lol yea fear factory does rule but the rest is just funny ass bullshit hahaha you know nothing about slipknot or me so go do some research then come talk to me

  • haha yeah i know they SUCK!

    thats what i know!

    they did their thing years ago...but its just shit now!

    admit it!

    i know all there is to know!

  • hahaha right you know nothing there new stuff kicks ass

  • there new stuff is good, but its not slipknot

    its stone sour wearing masks

  • their new stuff is amazing give me whatever you are smoking you aren't allowed to comment anymore

  • who me

  • You know all there is to know? You ignorant, God Complex, fucker!

  • Burton kind of looks like Corey Taylor

  • i think hes just got a sore throat from shouting too much

  • No man I love fear factory and Ive seen early live performances and he just doesnt have the "juice". I cover these songs with no problem. I was disappointed when I first saw them live. Again I still love Fear factory.

  • Grande FF!!!estos sin Dino no son nadie

  • TRUE FUCKING METAL!!! SUTCH HUGE THING!\m/

  • they fuckin' rule

  • you can't tell how good his voice is here it might be the sound quality of the video.

  • hou, burton`s a bit annoying! :D

    but i like his studio stuff very much, and i think its alright to suck live a bit.. xD

    and a big lol @ cazares xD

  • why is he annoying?

  • because i think he sings not good :)

    had a very bad day probably..

  • yes, he wasnt well at this concert. check others out.

  • yup, thats y i meant he is very annyoing HERE on that one :)

    cheers!

  • gotta respect Burton gone out bein sick and crap and still done a great well done for him Hail Burton C Bell everyone

  • i love FF but hes not the best live singer...

  • OUT DOORS SOUNDS LIKE SHIT... but theres other vidz that burton just sounds GREAT.

  • Es terrible, corrosivo y poderoso.. clasico de fear... la mejor epoca. Pone la piel de gallina.

  • fear factory is the shit bro

  • \m/ love Fear Factory!

  • I saw Fear Factory back in I think 1998 when they were touring with Slayer. It was the first time I ever heard Fear Factory and I was totally blown away by them. Those cool vocal effects totally blow you away live. It was one of the best sounding metal shows I have ever seen. Fear Factory is one of the coolest and original sounding bands out there.

  • There aren't a lot of bands that don't have their voice edited. Burton is a God, always will be. Live performances = sweaty, hot, tiring, therefore this performance is great. =)

  • he was sick on the performance

  • So burton's vocals are synthesized on the cd's, why don't they do it live? He's trying to make up for it on stage and obviously doesn't sound as good.

  • burton's vocals are obviously treated alot in the studio with pitch correction and harmonies. but, I think burton does a pretty good job replicating that live. obviously its not going to sound as good, but screaming and singing some very ambitious melodic parts is incredibly hard to do. there are some excellent live performances on youtube, check out the gigantour stuff, the wocester gig, the big day out stuff and anything from 1998/1999, fear factory were at their absolute best then.

  • Bell has a stage performance that kinda reminds of me of Corey Taylor w/out the jumping around

  • 3:00-4:25 Always Gives Me The HeeBiJeebis... In A Good Way....

  • same here, some good shit

  • yeah but it'd be real hard to go from heavy to singing, specially when your out of breath-and the sudden change would be very difficult to master. i really thought when i first listened to fear factory albums that theres no way he could reproduce that voice but he does an awesome job. fear factory are so highly underrated even if they do fall under nu metal or industrial metal or whatever its called. i think if you can enjoy a band than they're good fuck all this labelling shit.

  • i also heard that after his days of Concrete Burton fucked his voice over pretty good, ive never heard anything good about the singing in live performances. but that doesnt mean they dont fucking kick ass in each of their cd's.

  • I think that Burton sounds better live xP when he's doing the dry lung vocals

  • the single greatest band in history. so underrated and unappreciated. each record is a masterpiece and they deserve more respect for what they have done for modern metal. fear factory forever!!

  • and the greatest comment on youtube man! i fuckin love every album they put out man!

  • agreed multiplied by forever.

  • Fuck you, this song PWNS!

  • I miss dino cezares so bad its retarded. He was a key part of the original band and now that hes gone they sound so different. PLEASE COME BACK DINO!!!!!

  • Hell yea Dino come back....or go on tour with both bands!!!!! that be fucking amazing!!!!!!!

  • dinos are extinct man sorry.

    but the good news is that us humans are alive !

    ;)

  • hahaha

  • Lo más grande FF!!!!!

  • this crowd is so stupid...

  • mhm ich hab Fear Factory auf SUMMER-BREZZE 2006 gehört verdammt waren die geil. FFFFEEEEEEEEEAAAAAAAARRRRRRRRR­RRRRRR FFFFAAAAAACCCCCCCCTTTTTTTTOOOO­RRRRRRRRYYYYYYYYY RULZ

  • Dino RULZ!!!:D

  • shock !!!!!!!!!!!!!

  • lol i love the bass in this song when he yells out shock the first time

  • Christian is the fucking man.. he rules