Fear Factory was a heavy influence on Slipknot. You can tell. Shawn even said that he was stoked to be on Ozzfest 99 with them headlining the second stage.
Anyway, everybody rips everyone off. It's how music gets made. Bands take inspiration from eachother. That being said, I love both bands. No argument necessary.
COREY TAYLOR SUCKS BURTON I MEAN NOT BURTON'S BUT CAZARES DICK HAHAHAHAHAHHA,AND BY THE WAY SK SAID ONCE THEY MEANT TO BE BIGGER THAN METALLICA,HETFIELD NAILED THEM ALL AND LARS AND KIRK NAILED JORDINSON,HAHAHAHAHAHAHAHAHA PERIOD AS SK SAID ''BEFORE I FORGET'' THE LIKE NOT BE LEFT BEHIND BUT TO GET FROM BEHIND'' THEY ARE ALL FAGGOTS WITH DISGUISES HAHAHAHHAHA
@filth69ify1 hey man im a fear factory fan i like the song "resurrection" an i agree with u that only a FEW bands still hav great music u gotta remember that Iron Maiden is one of those few bands. i mean cause hav u like listened to "phantom of the opera" "hallowed be thy name" "powerslave" "run to the hills" "fear of the dark" "number of the best" and " alexander the great???
2.just because you have to metal bands doesnt mean you gotta compare like little bitches
3. i believe we can all find common ground with justin beiber and all those cock sucking fags from disney, so therefore, we should burn that mother fucker DOWN!
first of all it looks like he has a little trouble with those high notes. SECONDLY this is FEAR FACTORY not Slipknot dammit so quit arguing you little bitches
Im a slipknot fan but im not saying things like "SlipKnoT iS ThE bEsT". And remember - not all slipknot fans listen only to slipknot. 1 more thing - call the band like its called - slipknot.. i know you hate it but wtf guys ? cant you understand that this is lame..
I think Obsolete has to be their best album, but I love all the ones I have (Soul of a New Machine, Demanufacture, Remanufacture, Obsolete, Digimortal, and Transgression). Each of those is great in its own way. I've heard one or two songs from Archetype that I'm not crazy about, and I have no idea what Concrete sounds like.
One of my favorite Fear Factory songs. I bought Obsolete about 10 years ago, and I still find it amazing. Great video, awesome quality. Burton's clean vocals do not sound as good live (I learned that first hand at a concert a few years ago) but you can't blame him. They produce the shit out of his clean vocals on the albums. His "death metal growl" sounds great though, as do Ray (who inspired me to start drumming myself), Dino and Christian...
dear god...fucking slipknot fans...."duuuh we're MAGGOTS! RAWR! Look how cool we are, we got are own dedicated slipknot fan name...MAGGOTS! but MAGGOTS is a hardcore name! RAWR!!!"
I like both Slipknot and FF. Fuck you guys. If someone says that they like brownies better than cake, you can't fucking say "no, cake is better, it tastes better" thats retarded
you people need to stop arguing wasting time and hatred on whi likes what band more... that hatred needs to be directed at the assholes who hate metal
FF are the grass routes, SN are great, love them both, respect each other, listen to all metal bands and keep the music alive! FF are so hard a and raw where as SN have the music and the show but.....both are awesome
I love Fear Factory, but I am still very very bitter for their policy of confiscating any recording equipment during their shows. I took a few quick clips on my phone a few years ago and they had security take my phone and take $100 memory card out. Why are other bands ok with this but not Fear Factory? Fans would like to have a little memento of the trip to see Fear Factory and who cares about a dinky camera phone clip?
When the vocals in this clip go high, the pitch is crappy at best.
fckn retardeds have some of you signed a contract with SK or FF ? let's face it theres no band with the perfect discography there are better songs than some others why just don't enjoy the music ? And are you that bad in real life ? LOL nerds
all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.
all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.
all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.
Slipknot is just radio friendly metal. I like Fear Factory and Slipknot both. I do think that Fear Factory is one of the most influential bands of the past 20 years. I also agree that music is art and should not be compared. Who is better vs who isn't is just stupid and a waste of time. If you like a band, good for you, I'm sure some people share your opinion. If you don't, then don't come around saying "they suck" or "so-and-so's better"....Be open minded and keep your mouth shut.
Can people not compare slipknot to these guys..thank you..ITS FUCKING ANNOYING JUST FUCK OFF AND SUCK COREY TAYLORS DICK IF U DONT LIKE THIS GET THE FUCK OFF THESE VIDEOS YOU NOOB PUSSIES!!
I never saw FF at a festival like this because didn't want to hear what to me sounds like distorted vocals and some of their music. I only saw them at much smaller venues like HOB to get the full impact from like fifty feet away and the music and vocals vibrated right through me-so intense
its a question of taste which band someone likes better or lesser, i know slipknot and FF and many others and both of them do a great job in my opinion ;-) stop comparing bands , music = art and therefor not competitive in my opinion ... listen to what u like and dont listen to something you like not, its that simple !
I think someone whos favorite band is morbid angel knows what death metal is. Its a simple fact that slipknot is influenced by death metal. A few of the guys in slipknot were in anal blast. I know thats more pornogrind than death, but they still have a common sound. I'm not trying to say that slipknot is the best band ever, but i am stating a fact.
Fear Factory are a fuckin industrial "big deal" metal band. Please dont compare them with "evil music for 14 years old kids" band, which is Slipknot . FF been around since the early 90s and were one of the most important band (together with Pantera) of this era. They influenced the whole modern metal/core scene (which sucks btw.)
Slipknot were and are a mainstream metal band that is embarrassing for the fans of REAL heavy music.
Slipknot is Nu Metal, Fear Factory - Industrial Death. There's a difference, don't you think? Oh, and FF are pioneers and have been around way more than knot.
@darknessawaits89 I like Slipknot, I don't think they can compare to alot of metal bands out there today? Hmmm, I think you should say 'Slipknot kid fans'.
@darknessawaits89 dude i tottaly agree with you slipknots alright but when i picked up a fear factory album i tossed the slipknot album out the window and now
@darknessawaits89 Slipknot isnt even metal hahahahah! so wheres the argument? Slipknot fans are anal as fuck and need to leave the Fear factory world alone because FF will ALWAYS be better than CLITKNOT!
Listen fagot Gene Hoglan play with very more aggressive bands like Death, Dark Angel, Testament, Strapping young lad, so go to eat scum, then Raymond Hoglan is better, and more professional because I have more time in the road that raymond, he begins in 1984 what was doing herrera in that moment ?, in the school starting to learn the alphabet, fucking ignorant.
Cazares is back, with burton c. bell, but the bassist and raymond isn't in this new line up, i hope that will be better because the new drummer was in the band Death and Testament, this gonna be huge.
First of all, learn how to type, you have spelling errors all over both of your comments... second of all, raymond herrara is one of the main reasons why fear factory is so fucking good, he's one of the FOUNDING members, and although gene hoglan is good, he's not raymond herrara.
Shitknot?, the poser copy of MR. BUNGLE?, juas,juas,juas, fucking shitty music slipknot if for faggots that likes mainstream MTV music. Period. And of course Fear Factory are better.
I love Fear Factory and I have seen them play better than this, maybe they were tired or ill or something, it happens to all of us. Burton does look like Corey Taylor a small bit, it also looks like the Slipknot S he has tattooed on his forearm, maybe i'm looking at it wrong though.
lol yea fear factory does rule but the rest is just funny ass bullshit hahaha you know nothing about slipknot or me so go do some research then come talk to me
No man I love fear factory and Ive seen early live performances and he just doesnt have the "juice". I cover these songs with no problem. I was disappointed when I first saw them live. Again I still love Fear factory.
I saw Fear Factory back in I think 1998 when they were touring with Slayer. It was the first time I ever heard Fear Factory and I was totally blown away by them. Those cool vocal effects totally blow you away live. It was one of the best sounding metal shows I have ever seen. Fear Factory is one of the coolest and original sounding bands out there.
There aren't a lot of bands that don't have their voice edited. Burton is a God, always will be. Live performances = sweaty, hot, tiring, therefore this performance is great. =)
So burton's vocals are synthesized on the cd's, why don't they do it live? He's trying to make up for it on stage and obviously doesn't sound as good.
burton's vocals are obviously treated alot in the studio with pitch correction and harmonies. but, I think burton does a pretty good job replicating that live. obviously its not going to sound as good, but screaming and singing some very ambitious melodic parts is incredibly hard to do. there are some excellent live performances on youtube, check out the gigantour stuff, the wocester gig, the big day out stuff and anything from 1998/1999, fear factory were at their absolute best then.
yeah but it'd be real hard to go from heavy to singing, specially when your out of breath-and the sudden change would be very difficult to master. i really thought when i first listened to fear factory albums that theres no way he could reproduce that voice but he does an awesome job. fear factory are so highly underrated even if they do fall under nu metal or industrial metal or whatever its called. i think if you can enjoy a band than they're good fuck all this labelling shit.
i also heard that after his days of Concrete Burton fucked his voice over pretty good, ive never heard anything good about the singing in live performances. but that doesnt mean they dont fucking kick ass in each of their cd's.
the single greatest band in history. so underrated and unappreciated. each record is a masterpiece and they deserve more respect for what they have done for modern metal. fear factory forever!!
I miss dino cezares so bad its retarded. He was a key part of the original band and now that hes gone they sound so different. PLEASE COME BACK DINO!!!!!
mhm ich hab Fear Factory auf SUMMER-BREZZE 2006 gehört verdammt waren die geil. FFFFEEEEEEEEEAAAAAAAARRRRRRRRRRRRRRR FFFFAAAAAACCCCCCCCTTTTTTTTOOOORRRRRRRRYYYYYYYYY RULZ
Fear Factory was a heavy influence on Slipknot. You can tell. Shawn even said that he was stoked to be on Ozzfest 99 with them headlining the second stage.
Anyway, everybody rips everyone off. It's how music gets made. Bands take inspiration from eachother. That being said, I love both bands. No argument necessary.
SteveElMonk86 2 months ago
One of the best introductions to an album and song in the whole musical world, this song gives so much energy.
Galendramatik 4 months ago
COREY TAYLOR SUCKS BURTON I MEAN NOT BURTON'S BUT CAZARES DICK HAHAHAHAHAHHA,AND BY THE WAY SK SAID ONCE THEY MEANT TO BE BIGGER THAN METALLICA,HETFIELD NAILED THEM ALL AND LARS AND KIRK NAILED JORDINSON,HAHAHAHAHAHAHAHAHA PERIOD AS SK SAID ''BEFORE I FORGET'' THE LIKE NOT BE LEFT BEHIND BUT TO GET FROM BEHIND'' THEY ARE ALL FAGGOTS WITH DISGUISES HAHAHAHHAHA
adolphmetal 5 months ago
is one of the shows where Burton loses his voice? X-D
systemaddictshock 7 months ago
Burton sounds gassed but thats ok the end of the song still kicks ass.
Chalkyo 7 months ago
Dino was fuckin gettin' down at 0:35 lol Dino is a Beast!!!!
k5lta 7 months ago
fukin great!
thothblastbeast2 9 months ago
fajny kilp
adam1982adam 9 months ago
After the 90's most bands fell apart but Fear Factory are one of the few bands that still have great music.
filth69ify1 10 months ago 3
@filth69ify1 hey man im a fear factory fan i like the song "resurrection" an i agree with u that only a FEW bands still hav great music u gotta remember that Iron Maiden is one of those few bands. i mean cause hav u like listened to "phantom of the opera" "hallowed be thy name" "powerslave" "run to the hills" "fear of the dark" "number of the best" and " alexander the great???
thunderblaster31 5 months ago
Slipknot fans: SHUT UP.
Slipknot was good... up until 2007. Now fucking SEETHER beats them.
And this is a Fear Factory video; why do you guys care?
TheGeek1028 11 months ago 5
ok people quit bitching slipknot and fear factory are good bands i personaly thing A7X is the best but thats my opinion so everyone stfu
Bigmac5528 11 months ago
1. to be honest, stop comparing everything.
2.just because you have to metal bands doesnt mean you gotta compare like little bitches
3. i believe we can all find common ground with justin beiber and all those cock sucking fags from disney, so therefore, we should burn that mother fucker DOWN!
ubermplalir 1 year ago 2
Slipknot was good when they first came out, now they're weaker than Poison.
Z1CAUSEDEATH 1 year ago 2
Fear Factory is older, better and kicks more ass than shitsnot,,, shitsnot is gayy,, u cant compare with Fear Factory man,,,lol
1COALCHAMBER1 1 year ago
first of all it looks like he has a little trouble with those high notes. SECONDLY this is FEAR FACTORY not Slipknot dammit so quit arguing you little bitches
vincent6445 1 year ago
this song is good but it like resurrection better. THUNBS THIS UP IF YOU LIKE THE SONG RESURRECTION!!!!!!!!!!!!!!!!!!!!!!!!!
thunderblaster31 1 year ago
I will be the power surge...
viralencore84 1 year ago
petrifide, amplified .; i like that line
NigelAndres 1 year ago
it is good
NigelAndres 1 year ago
and now i;m complete, power source.
NigelAndres 1 year ago
and shocked to "peice-s"
NigelAndres 1 year ago
Comment removed
NigelAndres 1 year ago
My Favorite FF song Awesome!
ProdigalSin 1 year ago
slipknot i love but is shit if compare with titas of metal like fear factory ,pantera ,machine head and old sepultura slipknot is good but noob
OMONSTROBR 1 year ago
Im a slipknot fan but im not saying things like "SlipKnoT iS ThE bEsT". And remember - not all slipknot fans listen only to slipknot. 1 more thing - call the band like its called - slipknot.. i know you hate it but wtf guys ? cant you understand that this is lame..
Sparky666Pivot 1 year ago
@Sparky666Pivot shitknot shitknot shitknot shitknot go fuck urself bitch.
WhereThereDude 1 year ago
Comment removed
Sparky666Pivot 1 year ago
these guys are fucking legendary
xZoTiiKzZ 1 year ago
Does anyone care about slipcock?
rtyush 1 year ago
imagine if dino did a stage dive :O
fpsliams 1 year ago 5
Continued...
I think Obsolete has to be their best album, but I love all the ones I have (Soul of a New Machine, Demanufacture, Remanufacture, Obsolete, Digimortal, and Transgression). Each of those is great in its own way. I've heard one or two songs from Archetype that I'm not crazy about, and I have no idea what Concrete sounds like.
Slayer21394 1 year ago
One of my favorite Fear Factory songs. I bought Obsolete about 10 years ago, and I still find it amazing. Great video, awesome quality. Burton's clean vocals do not sound as good live (I learned that first hand at a concert a few years ago) but you can't blame him. They produce the shit out of his clean vocals on the albums. His "death metal growl" sounds great though, as do Ray (who inspired me to start drumming myself), Dino and Christian...
Slayer21394 1 year ago
0:33 was fucking terrible. this is way too fast.
n8decker 1 year ago
dear god...fucking slipknot fans...."duuuh we're MAGGOTS! RAWR! Look how cool we are, we got are own dedicated slipknot fan name...MAGGOTS! but MAGGOTS is a hardcore name! RAWR!!!"
MetalheadAlex9 1 year ago
fear factory owns
sigmasic 1 year ago
I like both FearFactory and Slipknot and I don't give shit about the shitty arguments. Grow up! Screw you guys, I'm going home.
kred666 1 year ago 3
I like both Slipknot and FF. Fuck you guys. If someone says that they like brownies better than cake, you can't fucking say "no, cake is better, it tastes better" thats retarded
r3dshrapnel 1 year ago 3
this kind of music suck shit
alaanees 1 year ago
you people need to stop arguing wasting time and hatred on whi likes what band more... that hatred needs to be directed at the assholes who hate metal
Obsoliit 1 year ago
FF are the grass routes, SN are great, love them both, respect each other, listen to all metal bands and keep the music alive! FF are so hard a and raw where as SN have the music and the show but.....both are awesome
startsem 1 year ago
I love Fear Factory, but I am still very very bitter for their policy of confiscating any recording equipment during their shows. I took a few quick clips on my phone a few years ago and they had security take my phone and take $100 memory card out. Why are other bands ok with this but not Fear Factory? Fans would like to have a little memento of the trip to see Fear Factory and who cares about a dinky camera phone clip?
When the vocals in this clip go high, the pitch is crappy at best.
itinkle 1 year ago
gooog very goood !!! fear factory_sickness
Mega6sic6 1 year ago
lol slipknot sucks balls actually
r1chie311music 1 year ago
btw is it me? or does burton has a slipknot tattoo in his arms? :$
eddiekicksurass666 1 year ago
@eddiekicksurass666 It's you.
RazoredToTheBone 1 year ago
@eddiekicksurass666 its not a slipknot tattoo,,,
fpsliams 1 year ago
@fpsliams yea it is, its slipknots symbol the bands are friends you know how many tours theve all done together... alot
Branden1119 1 year ago
what the fuck dude ive seen slipknot and im going to see FF there BOTH kicck-ass
eddiekicksurass666 1 year ago
fckn retardeds have some of you signed a contract with SK or FF ? let's face it theres no band with the perfect discography there are better songs than some others why just don't enjoy the music ? And are you that bad in real life ? LOL nerds
742617000027FR 1 year ago
This has been flagged as spam show
all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.
satanpie666 1 year ago
This has been flagged as spam show
all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.
satanpie666 1 year ago
all off you slipknot fanboys better shut ujp quick, because this band is basically responsible for slipknots sound, and the entire genre of metalcore.
satanpie666 1 year ago
that brootal vocals at 1:15. "i have become a tyyyren"
jurkis1 1 year ago
get to see them april 2nd fucking fear factory for life mother fuckers!
rockerguy015 2 years ago
@diabeticmonkey ur not stating a shit FUCK THE POSERS t(-.-)t
Xipazzz 2 years ago
Slipknot is just radio friendly metal. I like Fear Factory and Slipknot both. I do think that Fear Factory is one of the most influential bands of the past 20 years. I also agree that music is art and should not be compared. Who is better vs who isn't is just stupid and a waste of time. If you like a band, good for you, I'm sure some people share your opinion. If you don't, then don't come around saying "they suck" or "so-and-so's better"....Be open minded and keep your mouth shut.
whoohaaXL 2 years ago 7
Bahahah 3:52. Christian's like humping his bass.
EvilHippy38 2 years ago
@EvilHippy38 haha he realy loves that bass doesnt he
LewisTaylorRules08 1 year ago
Can people not compare slipknot to these guys..thank you..ITS FUCKING ANNOYING JUST FUCK OFF AND SUCK COREY TAYLORS DICK IF U DONT LIKE THIS GET THE FUCK OFF THESE VIDEOS YOU NOOB PUSSIES!!
laithlaith91 2 years ago 21
best song of FF for me, drummer is insane when i first listen the album in 1998 i couldn't believe the drums for real.
melihsahcan 2 years ago 5
@melihsahcan - very good....but no Tomas Haake :)
screwball82 2 years ago
I never saw FF at a festival like this because didn't want to hear what to me sounds like distorted vocals and some of their music. I only saw them at much smaller venues like HOB to get the full impact from like fifty feet away and the music and vocals vibrated right through me-so intense
wayshower13 2 years ago 3
its a question of taste which band someone likes better or lesser, i know slipknot and FF and many others and both of them do a great job in my opinion ;-) stop comparing bands , music = art and therefor not competitive in my opinion ... listen to what u like and dont listen to something you like not, its that simple !
soloton 2 years ago
I think someone whos favorite band is morbid angel knows what death metal is. Its a simple fact that slipknot is influenced by death metal. A few of the guys in slipknot were in anal blast. I know thats more pornogrind than death, but they still have a common sound. I'm not trying to say that slipknot is the best band ever, but i am stating a fact.
diabeticmonkey 2 years ago
Fear Factory are a fuckin industrial "big deal" metal band. Please dont compare them with "evil music for 14 years old kids" band, which is Slipknot . FF been around since the early 90s and were one of the most important band (together with Pantera) of this era. They influenced the whole modern metal/core scene (which sucks btw.)
Slipknot were and are a mainstream metal band that is embarrassing for the fans of REAL heavy music.
Grabash666 2 years ago 5
I definitely wouldn't consider slipknot nu metal anymore. Way more death in their sound.
diabeticmonkey 2 years ago
hahahahahah you are funny man!
Are you sure, you know what death metal is?! I think you dont.
"Slipknot are death metal " - Ohhh boy, nice joke :)
Grabash666 2 years ago
Slipknot is Nu Metal, Fear Factory - Industrial Death. There's a difference, don't you think? Oh, and FF are pioneers and have been around way more than knot.
cyberneticchaos 2 years ago 8
0:44 Check the dude in the down right corner. Thats a metalhead stoner. =)
adrianvdb 2 years ago
hahaha
Tru
haleyg8 2 years ago
TRUE********************
Nuditeaf 2 years ago
funny to see comment about slipknot on every metal song ive seen so far :/
like its the only band....
tritrium 2 years ago
Slipknot fans: Get the fuck out. You're always saying that knot is better than all other metal bands. GTFO now. Fear Factory owns shitsnot.
darknessawaits89 2 years ago 72
seriously, slipknot's fucking gay now. i can respect their demo, but everything is gay as hell.
obsolete=best album ever
fearrising10 2 years ago 3
hey kid, shut up
Rocket1771 2 years ago
hey matt, shut up haha ;]
fearrising10 2 years ago
They do Own slipknot. I like slipknot alot. But Fear Factory is wayyyyyyy better.
Idkfawin32 2 years ago 3
im a slipknot fan but i know for a fact fear factory is better than them
iRockDanny 2 years ago 6
@darknessawaits89 I like Slipknot, I don't think they can compare to alot of metal bands out there today? Hmmm, I think you should say 'Slipknot kid fans'.
DLH8DeMoN 1 year ago
@darknessawaits89 dude i tottaly agree with you slipknots alright but when i picked up a fear factory album i tossed the slipknot album out the window and now
FF is my fav band
alphaqup1 1 year ago
@darknessawaits89 Amen to that
Frizz529 1 year ago
@darknessawaits89 Slipknot isnt even metal hahahahah! so wheres the argument? Slipknot fans are anal as fuck and need to leave the Fear factory world alone because FF will ALWAYS be better than CLITKNOT!
mushrmhd6661 1 year ago
@darknessawaits89 i love fear factory as much as i love slipknot, i find that a very unfair statement
slipknotcoreyno8 1 year ago
@darknessawaits89 i total agree how can u compare something like slipknot which just random shit to Fear Factory which just rocks
hmzaox 1 year ago
@darknessawaits89 i like slipknot but i definitly like fear factory better
funkymonkey0426 1 year ago 2
Every bloody music video on youtube I see arguments about whether Slipknot is better than whoever. Its music! Its opinion! Just listen or gtfo.
RossWildish 2 years ago 3
okay to u who r arguing over whos better notice wht tat he has on his forarm
lilshaggy2dope4life 2 years ago
is very good
studiobombinflame 2 years ago
FF are great but C Bell sucks at clean sing
italianguerrilla 2 years ago 3
totally out of key isnt he? its the same for most metal bands these days, its a shame really
zildro1 2 years ago
I totally agree
italianguerrilla 2 years ago
Why argue over such trivial BS.2 completely different types of music.DUMB ASSES!
scothesot 2 years ago
Listen fagot Gene Hoglan play with very more aggressive bands like Death, Dark Angel, Testament, Strapping young lad, so go to eat scum, then Raymond Hoglan is better, and more professional because I have more time in the road that raymond, he begins in 1984 what was doing herrera in that moment ?, in the school starting to learn the alphabet, fucking ignorant.
Mikepatton89 2 years ago
This has been flagged as spam show
Fear factory doesnt own slipknot, thats an absurd childish statement.
Mortikhan 2 years ago
actually being a slipknot (see my name?) I gotta say fear factory is WAY better
Fergusforslipknot 2 years ago 4
fear factorys really beast ass when it comes to slipknot ehhh id say there both really good
pikamasta55 2 years ago
Fuck slipknot Fear factory fucking owns them!
EVEprobe 2 years ago 8
Cazares is back, with burton c. bell, but the bassist and raymond isn't in this new line up, i hope that will be better because the new drummer was in the band Death and Testament, this gonna be huge.
Mikepatton89 2 years ago
First of all, learn how to type, you have spelling errors all over both of your comments... second of all, raymond herrara is one of the main reasons why fear factory is so fucking good, he's one of the FOUNDING members, and although gene hoglan is good, he's not raymond herrara.
Downnola13 2 years ago
Shitknot?, the poser copy of MR. BUNGLE?, juas,juas,juas, fucking shitty music slipknot if for faggots that likes mainstream MTV music. Period. And of course Fear Factory are better.
Mikepatton89 2 years ago 2
damn strait mike! damn strait!
1504hogner 2 years ago
Fear Factory was the Fucking loudest concert I have ever been too. My fuckingn ears rang for a god damn week.
soggdogg 2 years ago 2
tell me about it i gat out from one of there concert all beat up from to much muchpiting
djpipotheoriginal 2 years ago
dino cazares rulez!!!!!!
Xxkannibalmaggot7xX 2 years ago 3
Used to sing a lil´better
ORPHISMO 2 years ago
man raymond is a machine...
wombleguts 2 years ago 5
This has been flagged as spam show
man they suck. they kinda sound like slipknot. both weak ass bands.
sgman61791 3 years ago
hey,man,fear factory is older than slipknot
sakmtlas 3 years ago 38
hahaha and better than Slipknot
DAATHmaniac1 2 years ago 7
wat's with all the bitching about fucking slipknot...
fear factory and slipknot r both kickass bands so leav it at that faggots!
IAmWalshy 3 years ago
great band
(man theyre fat!!!)
888peanut888 3 years ago 3
This has been flagged as spam show
I Fucking Love Fear Factory !
areld 3 years ago
i miss violator, i mean... Dino XD
IDisasterpiece 3 years ago 2
I love Fear Factory and I have seen them play better than this, maybe they were tired or ill or something, it happens to all of us. Burton does look like Corey Taylor a small bit, it also looks like the Slipknot S he has tattooed on his forearm, maybe i'm looking at it wrong though.
postmortum7688 3 years ago
I think it's just a tribal tattoo...could be wrong, but that's unlikely, lol
timendo215 3 years ago
you mean to say...
Slipshit must have stolen their logo from Burton's arms?
i kinda thought that...but the reality is that they probably took Burton's arm and Seplutrua's logo and boom...Slip-in-shit!
lol why are we even talking about this?
lol slipknot sucks gay cock!
AustinKronix 3 years ago 3
This comment has received too many negative votes show
fuck you slipknot kicks ass you mother fucker there one of the best bands ever
BPLIFE 3 years ago
hahah lol thats great...for a second there i thought you were serious...i know...slip-n-nut is such shit!
i'm glad you see things clearly! lol
FF rules you bitch!!!!
BTW
I will not stand for condemnation
Ive become the volts
To lead the revolt
Fuck with me ensues certain danger
AustinKronix 3 years ago 2
lol yea fear factory does rule but the rest is just funny ass bullshit hahaha you know nothing about slipknot or me so go do some research then come talk to me
BPLIFE 3 years ago
haha yeah i know they SUCK!
thats what i know!
they did their thing years ago...but its just shit now!
admit it!
i know all there is to know!
AustinKronix 3 years ago
hahaha right you know nothing there new stuff kicks ass
BPLIFE 3 years ago
there new stuff is good, but its not slipknot
its stone sour wearing masks
MrJoeyMonster 2 years ago
their new stuff is amazing give me whatever you are smoking you aren't allowed to comment anymore
WhatWillBecome1 3 years ago
who me
BPLIFE 3 years ago
You know all there is to know? You ignorant, God Complex, fucker!
TitanTron6 3 years ago 3
Burton kind of looks like Corey Taylor
ImmortalCadaver 3 years ago
i think hes just got a sore throat from shouting too much
jackm0179 3 years ago
No man I love fear factory and Ive seen early live performances and he just doesnt have the "juice". I cover these songs with no problem. I was disappointed when I first saw them live. Again I still love Fear factory.
jjallen1976 3 years ago
Grande FF!!!estos sin Dino no son nadie
thepayofreestyler 3 years ago
TRUE FUCKING METAL!!! SUTCH HUGE THING!\m/
FastAlien 3 years ago
they fuckin' rule
HorrorxDeathxMetal 3 years ago
you can't tell how good his voice is here it might be the sound quality of the video.
pizzabeermusic 3 years ago
hou, burton`s a bit annoying! :D
but i like his studio stuff very much, and i think its alright to suck live a bit.. xD
and a big lol @ cazares xD
freakguitar1 3 years ago
why is he annoying?
gl0ss 3 years ago
because i think he sings not good :)
had a very bad day probably..
freakguitar1 3 years ago
yes, he wasnt well at this concert. check others out.
gl0ss 3 years ago
yup, thats y i meant he is very annyoing HERE on that one :)
cheers!
freakguitar1 3 years ago
gotta respect Burton gone out bein sick and crap and still done a great well done for him Hail Burton C Bell everyone
DAATHmaniac1 3 years ago
i love FF but hes not the best live singer...
deinemutter2002 3 years ago
OUT DOORS SOUNDS LIKE SHIT... but theres other vidz that burton just sounds GREAT.
hendrixonlsd 3 years ago
Es terrible, corrosivo y poderoso.. clasico de fear... la mejor epoca. Pone la piel de gallina.
pabloontube 3 years ago
fear factory is the shit bro
metalfuckme 3 years ago 3
\m/ love Fear Factory!
Slania293 3 years ago
I saw Fear Factory back in I think 1998 when they were touring with Slayer. It was the first time I ever heard Fear Factory and I was totally blown away by them. Those cool vocal effects totally blow you away live. It was one of the best sounding metal shows I have ever seen. Fear Factory is one of the coolest and original sounding bands out there.
megamatt541 3 years ago 9
There aren't a lot of bands that don't have their voice edited. Burton is a God, always will be. Live performances = sweaty, hot, tiring, therefore this performance is great. =)
KoRn93Metallica81 3 years ago 7
he was sick on the performance
samthejokerman 3 years ago
So burton's vocals are synthesized on the cd's, why don't they do it live? He's trying to make up for it on stage and obviously doesn't sound as good.
uwisssh 3 years ago
burton's vocals are obviously treated alot in the studio with pitch correction and harmonies. but, I think burton does a pretty good job replicating that live. obviously its not going to sound as good, but screaming and singing some very ambitious melodic parts is incredibly hard to do. there are some excellent live performances on youtube, check out the gigantour stuff, the wocester gig, the big day out stuff and anything from 1998/1999, fear factory were at their absolute best then.
scumgrief2007666 3 years ago
Bell has a stage performance that kinda reminds of me of Corey Taylor w/out the jumping around
DEATHxLOGIC 3 years ago
3:00-4:25 Always Gives Me The HeeBiJeebis... In A Good Way....
NigelAndres 3 years ago 3
same here, some good shit
RobHCTRC 3 years ago
yeah but it'd be real hard to go from heavy to singing, specially when your out of breath-and the sudden change would be very difficult to master. i really thought when i first listened to fear factory albums that theres no way he could reproduce that voice but he does an awesome job. fear factory are so highly underrated even if they do fall under nu metal or industrial metal or whatever its called. i think if you can enjoy a band than they're good fuck all this labelling shit.
tallicafan86 3 years ago
i also heard that after his days of Concrete Burton fucked his voice over pretty good, ive never heard anything good about the singing in live performances. but that doesnt mean they dont fucking kick ass in each of their cd's.
gsvivi 3 years ago
I think that Burton sounds better live xP when he's doing the dry lung vocals
xx0utlinexx 3 years ago
the single greatest band in history. so underrated and unappreciated. each record is a masterpiece and they deserve more respect for what they have done for modern metal. fear factory forever!!
monnymonmonmon 3 years ago 18
and the greatest comment on youtube man! i fuckin love every album they put out man!
slaytura 3 years ago 12
This has been flagged as spam show
Fuckin right man
antixbush 3 years ago
agreed multiplied by forever.
bleedtheworld 3 years ago
Fuck you, this song PWNS!
Asesinobrujeria 3 years ago 8
I miss dino cezares so bad its retarded. He was a key part of the original band and now that hes gone they sound so different. PLEASE COME BACK DINO!!!!!
Edgecrusher10 3 years ago 2
Hell yea Dino come back....or go on tour with both bands!!!!! that be fucking amazing!!!!!!!
RedInMyCite 3 years ago
dinos are extinct man sorry.
but the good news is that us humans are alive !
;)
whatsthatcar 3 years ago 4
hahaha
antixbush 3 years ago
Lo más grande FF!!!!!
Thanatosartrip 3 years ago
this crowd is so stupid...
hatebreed5656 3 years ago
mhm ich hab Fear Factory auf SUMMER-BREZZE 2006 gehört verdammt waren die geil. FFFFEEEEEEEEEAAAAAAAARRRRRRRRRRRRRRR FFFFAAAAAACCCCCCCCTTTTTTTTOOOORRRRRRRRYYYYYYYYY RULZ
Ju34lian 4 years ago
Dino RULZ!!!:D
SEBERATTILA 4 years ago
shock !!!!!!!!!!!!!
puertofreddo 4 years ago
lol i love the bass in this song when he yells out shock the first time
wildfan0109 4 years ago
Christian is the fucking man.. he rules
surenopimp 4 years ago