You're welcome. I'm not clear as to your point. We (humanity) have a common knowledge. As scientists we say that something is known, even if we personally don't know it. For example, the DNA sequence of the platypus was recently determined, so it is 'known', though I haven't seen any of the sequence yet. The point is that should I need that information, I can (rather quickly!) look it up. Our knowledge (in that sense) is vast and growing rapidly.
google: platypus genome ncbi ... 3 minutes (including futzing around in the wrong place! Here is the platyplus genome start, chromosome 1, NC_009094: ATGCCGTTCGTTCCCCTCTGCTCCTTCCCCGCCGGGATCCACCCAAACCCCTTCAGTGGGGTGGGACCTG
So knowledge does not depend on who you talk to unless there is someone (such as a creationist or IDiot) who refuses to accept things that are known based on a whim. In particular, since Lincoln's time we have learned about the big bang (microwave background radiation, red shift, Penzias and Wilson, COBE, WMAP) which severely contradicts the bible-predicted age of the earth of 6 thousand years. So our knowledge expanded 13.73 +/- 0.12 billion years into the heavens and the bible now fails.
You are 16 and haven't learned enough yet, so you are excused for these errors. However, you clearly did not read and understand my previous comment. Read more carefully next time. To catch up to modern knowledge, read about spectral lines from elements. (Throw a pinch of salt into a flame - what color is it?) Then read about the Hubble red shift curve. Read Penzias and Wilson's amazing discovery. That will bring you up to something like 1965. Finally to get modern, read about COBE and WMAP.
Mr. or Ms. Farvision, the only confusing thing we have in our day is EXISTANCE. Our existance in this world is based on what we have, true existance should b based on who we are and are we who we should be. If not then we need to look outside of ourselves. If that includes someone reaching out to the religous than so be it.
josh188: There are no 'shoulds'. "Should" is a trick to get somebody to do or think something. I don't mind if someone believes in Santa, just that the consequence of them bombing train stations all the time is repugnant. Better that people stop believing in Santa.
Sure it is. Although it depends solely on who you're talking to. I won't default my knowledge on a scientific theory that can only say so much before the scientists scratch their heads and utter, "I don't know." Thanks for the comment :)
very boring.
you wasted your time in making this, I am sorry to say.
maybe try sth with a little more information next time.
afielsch 1 year ago
@afielsch The perfect grade is what counted (in class), not your humble opinion. Thanks for watching, anyway
tricofilms 1 year ago
This has been flagged as spam show
whos that sexy man
dstipek 2 years ago
very well done.
SpeedyPrince 3 years ago
I found God and restored my faith in that same House of God =)
kirschenman 3 years ago
Yes! You used my LOST music for the beginning! :-D
Desmus55 3 years ago
hey guys i liked this alot.
ToddawgFilms 3 years ago
Thank You. =)
tricofilms 3 years ago
You're welcome. I'm not clear as to your point. We (humanity) have a common knowledge. As scientists we say that something is known, even if we personally don't know it. For example, the DNA sequence of the platypus was recently determined, so it is 'known', though I haven't seen any of the sequence yet. The point is that should I need that information, I can (rather quickly!) look it up. Our knowledge (in that sense) is vast and growing rapidly.
farvision 3 years ago
google: platypus genome ncbi ... 3 minutes (including futzing around in the wrong place! Here is the platyplus genome start, chromosome 1, NC_009094: ATGCCGTTCGTTCCCCTCTGCTCCTTCCCCGCCGGGATCCACCCAAACCCCTTCAGTGGGGTGGGACCTG
farvision 3 years ago
So knowledge does not depend on who you talk to unless there is someone (such as a creationist or IDiot) who refuses to accept things that are known based on a whim. In particular, since Lincoln's time we have learned about the big bang (microwave background radiation, red shift, Penzias and Wilson, COBE, WMAP) which severely contradicts the bible-predicted age of the earth of 6 thousand years. So our knowledge expanded 13.73 +/- 0.12 billion years into the heavens and the bible now fails.
farvision 3 years ago
I want to remind you that the big band is only a theory, and one with lack of evidence as well.
SpeedyPrince 3 years ago
You are 16 and haven't learned enough yet, so you are excused for these errors. However, you clearly did not read and understand my previous comment. Read more carefully next time. To catch up to modern knowledge, read about spectral lines from elements. (Throw a pinch of salt into a flame - what color is it?) Then read about the Hubble red shift curve. Read Penzias and Wilson's amazing discovery. That will bring you up to something like 1965. Finally to get modern, read about COBE and WMAP.
farvision 3 years ago
lol im glad you liked the movie ;D
dstipek 3 years ago
dstipek, I was responding to SpeedyPrince. Youtube is terribly bad at making sensible commenting technology.
farvision 3 years ago
If only YouTube was like Vimeo... if only...
tricofilms 3 years ago
seems to be flat comments. Not good. Better to have nested comments of any depth. Youtube only has one depth which is totally confusing.
farvision 3 years ago
Mr. or Ms. Farvision, the only confusing thing we have in our day is EXISTANCE. Our existance in this world is based on what we have, true existance should b based on who we are and are we who we should be. If not then we need to look outside of ourselves. If that includes someone reaching out to the religous than so be it.
josh188 2 years ago
josh188: There are no 'shoulds'. "Should" is a trick to get somebody to do or think something. I don't mind if someone believes in Santa, just that the consequence of them bombing train stations all the time is repugnant. Better that people stop believing in Santa.
farvision 2 years ago
Are you serious? Simply Google "Big BANG" for aw-inspiring information! Welcome to the 21st century!
fineesmendez 2 years ago
Lincoln's quote is no longer valid, we know more now.
farvision 3 years ago
Sure it is. Although it depends solely on who you're talking to. I won't default my knowledge on a scientific theory that can only say so much before the scientists scratch their heads and utter, "I don't know." Thanks for the comment :)
tricofilms 3 years ago
Wow...this...was awesome.
MrPatriotic 3 years ago
Thanks m8! We're happy with it ^_^
tricofilms 3 years ago
=) Good!
MrPatriotic 3 years ago
well done
smiles146 3 years ago
Thank you
tricofilms 3 years ago
cool =)
dstipek 3 years ago